Incidental Mutation 'R8553:2210016F16Rik'
ID659984
Institutional Source Beutler Lab
Gene Symbol 2210016F16Rik
Ensembl Gene ENSMUSG00000021550
Gene NameRIKEN cDNA 2210016F16 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R8553 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location58379817-58385225 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58384880 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 92 (T92M)
Ref Sequence ENSEMBL: ENSMUSP00000022032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022032]
Predicted Effect probably damaging
Transcript: ENSMUST00000022032
AA Change: T92M

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022032
Gene: ENSMUSG00000021550
AA Change: T92M

DomainStartEndE-ValueType
low complexity region 31 41 N/A INTRINSIC
Pfam:Q_salvage 53 338 9.7e-122 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,881,021 D176E probably benign Het
4933427I04Rik A G 4: 123,860,534 I80M probably benign Het
Aga G A 8: 53,520,332 R255H probably damaging Het
Anapc1 G A 2: 128,619,913 P1757L possibly damaging Het
Arfgef3 T A 10: 18,603,530 I1446L probably damaging Het
Auts2 T C 5: 131,440,143 T779A probably benign Het
Cacna1s T C 1: 136,091,802 S778P possibly damaging Het
Cep164 A T 9: 45,807,210 probably benign Het
Cmya5 T C 13: 93,093,796 T1595A probably benign Het
Csmd3 G T 15: 47,621,328 T3214K possibly damaging Het
Dpy30 A G 17: 74,315,918 L23P probably damaging Het
Edrf1 A G 7: 133,650,318 E391G possibly damaging Het
Egflam A T 15: 7,207,748 V985E probably damaging Het
Elmo3 T C 8: 105,307,178 V201A probably benign Het
Epb41l5 T A 1: 119,549,941 D700V possibly damaging Het
Esr1 T C 10: 4,997,847 S467P probably damaging Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Fam189b A C 3: 89,186,846 D322A possibly damaging Het
Fancm A C 12: 65,126,695 N1927T possibly damaging Het
Gcfc2 A G 6: 81,935,963 T248A probably benign Het
Gm29106 T A 1: 118,200,419 C614S probably damaging Het
Greb1 T C 12: 16,723,327 T249A probably benign Het
Hectd4 T C 5: 121,353,598 S3700P possibly damaging Het
Hr T C 14: 70,567,525 L950P probably damaging Het
Hsd3b3 T A 3: 98,743,889 T82S possibly damaging Het
Ifit2 C A 19: 34,573,138 A26E probably benign Het
Igsf9b A G 9: 27,333,443 D902G probably damaging Het
Itga4 G A 2: 79,301,061 R591Q probably damaging Het
Kcnb1 A T 2: 167,104,611 S772R possibly damaging Het
Klhl32 T A 4: 24,629,343 I213L probably benign Het
Lcn3 A T 2: 25,766,335 probably null Het
Lpin2 T A 17: 71,231,237 S293T probably damaging Het
Magi2 T C 5: 20,651,200 F840S probably benign Het
Myt1 G A 2: 181,797,551 E289K possibly damaging Het
Ndst4 A G 3: 125,710,107 S8G probably damaging Het
Nlrp4f T C 13: 65,195,438 D109G possibly damaging Het
Olfr214 G T 6: 116,557,328 R301L probably damaging Het
Pcdhb12 C T 18: 37,437,634 A611V probably damaging Het
Pcif1 A T 2: 164,886,497 I225F probably damaging Het
Peli3 A G 19: 4,934,932 F150L probably damaging Het
Rfx7 A G 9: 72,611,804 T263A probably damaging Het
Rpn1 A G 6: 88,095,557 Y294C probably damaging Het
Rusc2 T A 4: 43,416,508 S605T probably benign Het
Sec23ip A C 7: 128,754,053 Q300P probably damaging Het
Sh2d3c A G 2: 32,745,913 T98A probably damaging Het
Siah3 T A 14: 75,525,627 I106K probably benign Het
Spns2 C T 11: 72,457,227 D305N probably damaging Het
Sult1a1 G T 7: 126,674,161 Q177K probably benign Het
Tas2r109 A G 6: 132,980,208 I253T probably benign Het
Tcof1 T C 18: 60,831,571 D661G possibly damaging Het
Tdrd1 A G 19: 56,843,152 N325S probably damaging Het
Tfcp2l1 C A 1: 118,632,352 A58E probably damaging Het
Wdcp T C 12: 4,852,024 probably benign Het
Other mutations in 2210016F16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:2210016F16Rik APN 13 58381976 missense probably damaging 1.00
IGL02302:2210016F16Rik APN 13 58381935 missense probably damaging 1.00
PIT1430001:2210016F16Rik UTSW 13 58385013 nonsense probably null
R0055:2210016F16Rik UTSW 13 58384166 missense probably damaging 1.00
R0055:2210016F16Rik UTSW 13 58384166 missense probably damaging 1.00
R2874:2210016F16Rik UTSW 13 58382570 missense probably damaging 1.00
R3954:2210016F16Rik UTSW 13 58384389 missense probably damaging 0.97
R3956:2210016F16Rik UTSW 13 58384389 missense probably damaging 0.97
R4012:2210016F16Rik UTSW 13 58381986 nonsense probably null
R4212:2210016F16Rik UTSW 13 58381991 missense probably damaging 1.00
R4469:2210016F16Rik UTSW 13 58382425 missense probably damaging 1.00
R4712:2210016F16Rik UTSW 13 58381803 missense probably benign 0.06
R5401:2210016F16Rik UTSW 13 58382591 missense probably benign
R6876:2210016F16Rik UTSW 13 58385096 missense probably damaging 1.00
R6957:2210016F16Rik UTSW 13 58381961 missense probably damaging 1.00
R7285:2210016F16Rik UTSW 13 58384385 missense probably damaging 1.00
R7599:2210016F16Rik UTSW 13 58381835 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGGCCTAATCAGCTGGATG -3'
(R):5'- TCCGGGTTCGAAACAGCATG -3'

Sequencing Primer
(F):5'- TGAACAGGACTACTCTGCCTG -3'
(R):5'- TTCGTGGCCGAGAACAGTC -3'
Posted On2021-01-18