Incidental Mutation 'R8554:Vmn2r1'
ID660006
Institutional Source Beutler Lab
Gene Symbol Vmn2r1
Ensembl Gene ENSMUSG00000027824
Gene Namevomeronasal 2, receptor 1
SynonymsEG56544, V2r83
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R8554 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location64081642-64105458 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64089913 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 330 (I330T)
Ref Sequence ENSEMBL: ENSMUSP00000029406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029406]
Predicted Effect probably damaging
Transcript: ENSMUST00000029406
AA Change: I330T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029406
Gene: ENSMUSG00000027824
AA Change: I330T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 86 504 6e-92 PFAM
Pfam:NCD3G 546 599 2.4e-17 PFAM
Pfam:7tm_3 632 866 4.1e-48 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,296,897 Y94N possibly damaging Het
Adtrp G A 13: 41,816,160 T89I possibly damaging Het
Apc T C 18: 34,312,946 V947A probably damaging Het
Apob A C 12: 7,987,830 K334N probably damaging Het
BC048403 T A 10: 121,740,055 I27N probably benign Het
Camk2d A T 3: 126,770,799 Q119L possibly damaging Het
Ccdc60 A T 5: 116,190,112 F98I probably damaging Het
Cd47 A G 16: 49,867,941 T22A probably benign Het
Crat A G 2: 30,410,023 V115A probably benign Het
Csmd3 T C 15: 47,644,142 M2992V probably benign Het
Dsg4 T A 18: 20,453,043 N263K probably damaging Het
Eln A C 5: 134,710,110 probably benign Het
Ep300 A G 15: 81,639,027 E1284G unknown Het
Fam193a T A 5: 34,475,771 M122K probably benign Het
Fam46a T C 9: 85,326,731 D13G possibly damaging Het
Fam57a A G 11: 76,205,418 H124R probably damaging Het
Fcgr1 A T 3: 96,292,472 W40R probably damaging Het
Gm3486 T A 14: 41,487,162 Q84L probably damaging Het
Gm9513 A G 9: 36,476,492 I25V probably benign Het
Golga2 G A 2: 32,293,345 D80N probably damaging Het
Isg20 T C 7: 78,916,677 Y125H probably benign Het
Kdf1 A G 4: 133,528,877 I302V probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Lrp1b T A 2: 41,344,483 Q1038L probably benign Het
March6 G A 15: 31,482,830 H476Y probably damaging Het
Myom1 A G 17: 71,036,453 E215G possibly damaging Het
Olfr1228 T C 2: 89,249,251 T148A possibly damaging Het
Olfr132 T A 17: 38,130,598 Q198L probably damaging Het
Olfr223 A T 11: 59,589,486 L201Q possibly damaging Het
Pdlim2 T A 14: 70,171,249 T173S probably benign Het
Pitpnb T C 5: 111,346,506 M74T probably benign Het
Pou2f2 C A 7: 25,115,556 probably benign Het
Rab35 A C 5: 115,645,631 probably null Het
Rasef A T 4: 73,727,607 D508E probably benign Het
Rev3l T C 10: 39,806,842 S319P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgl3 A G 9: 21,988,863 S44P probably benign Het
Rnf214 C A 9: 45,867,499 probably null Het
Rpsa T C 9: 120,129,251 V76A possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Senp7 T C 16: 56,158,610 V529A probably benign Het
Siglecg C T 7: 43,408,896 S69L probably benign Het
Sos1 G T 17: 80,398,413 T1243K probably damaging Het
Tmc2 A G 2: 130,264,164 T872A probably benign Het
Tnfrsf8 A C 4: 145,296,941 C107W probably damaging Het
Tnn T C 1: 160,110,416 Y913C probably damaging Het
Ttn T C 2: 76,738,032 T19179A probably damaging Het
Usp42 T A 5: 143,720,382 K294N probably damaging Het
Vmn1r123 T A 7: 21,163,046 C288S probably benign Het
Vmn1r29 T A 6: 58,308,206 *304K probably null Het
Vmn2r16 A G 5: 109,364,131 I735V probably benign Het
Vmn2r65 T C 7: 84,946,752 I241M probably benign Het
Other mutations in Vmn2r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Vmn2r1 APN 3 64104968 nonsense probably null
IGL00335:Vmn2r1 APN 3 64105388 missense probably damaging 0.96
IGL01509:Vmn2r1 APN 3 64103045 missense probably benign 0.03
IGL01641:Vmn2r1 APN 3 64104503 missense probably benign 0.19
IGL01656:Vmn2r1 APN 3 64081853 missense probably damaging 0.96
IGL01927:Vmn2r1 APN 3 64081684 missense probably benign 0.01
IGL02093:Vmn2r1 APN 3 64104709 missense probably benign
IGL02146:Vmn2r1 APN 3 64104683 missense probably benign 0.39
IGL02186:Vmn2r1 APN 3 64081717 missense probably benign 0.01
IGL02320:Vmn2r1 APN 3 64081759 missense possibly damaging 0.61
IGL02423:Vmn2r1 APN 3 64090244 missense probably benign 0.00
IGL02709:Vmn2r1 APN 3 64104934 missense probably benign 0.24
R0034:Vmn2r1 UTSW 3 64090014 missense probably damaging 1.00
R0064:Vmn2r1 UTSW 3 64104788 missense possibly damaging 0.76
R0152:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0305:Vmn2r1 UTSW 3 64089666 missense probably damaging 1.00
R0314:Vmn2r1 UTSW 3 64086559 missense probably damaging 1.00
R0317:Vmn2r1 UTSW 3 64081819 missense possibly damaging 0.92
R0465:Vmn2r1 UTSW 3 64081759 missense possibly damaging 0.61
R1144:Vmn2r1 UTSW 3 64090120 missense probably damaging 1.00
R1163:Vmn2r1 UTSW 3 64086625 missense probably benign 0.03
R1448:Vmn2r1 UTSW 3 64101313 missense probably damaging 1.00
R1491:Vmn2r1 UTSW 3 64089613 missense probably damaging 1.00
R1543:Vmn2r1 UTSW 3 64089573 missense probably damaging 1.00
R1611:Vmn2r1 UTSW 3 64104537 nonsense probably null
R1676:Vmn2r1 UTSW 3 64090182 nonsense probably null
R1727:Vmn2r1 UTSW 3 64081742 missense probably benign
R1851:Vmn2r1 UTSW 3 64101505 missense probably benign 0.32
R3080:Vmn2r1 UTSW 3 64089784 missense probably damaging 1.00
R3790:Vmn2r1 UTSW 3 64086764 critical splice donor site probably null
R4111:Vmn2r1 UTSW 3 64089755 missense probably benign 0.23
R4689:Vmn2r1 UTSW 3 64104653 missense possibly damaging 0.94
R4747:Vmn2r1 UTSW 3 64081846 missense probably benign 0.00
R4970:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5033:Vmn2r1 UTSW 3 64105080 missense probably damaging 1.00
R5086:Vmn2r1 UTSW 3 64089997 missense probably benign 0.00
R5112:Vmn2r1 UTSW 3 64090123 missense possibly damaging 0.81
R5385:Vmn2r1 UTSW 3 64101398 missense possibly damaging 0.89
R5629:Vmn2r1 UTSW 3 64105117 missense possibly damaging 0.87
R5762:Vmn2r1 UTSW 3 64090053 missense probably benign 0.24
R5867:Vmn2r1 UTSW 3 64104569 missense probably benign
R5893:Vmn2r1 UTSW 3 64086553 missense probably damaging 1.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6037:Vmn2r1 UTSW 3 64081729 missense probably benign 0.00
R6290:Vmn2r1 UTSW 3 64105452 missense probably benign 0.02
R6443:Vmn2r1 UTSW 3 64104953 missense possibly damaging 0.78
R6464:Vmn2r1 UTSW 3 64101345 missense probably benign
R6826:Vmn2r1 UTSW 3 64105146 nonsense probably null
R6874:Vmn2r1 UTSW 3 64104955 missense probably damaging 1.00
R6882:Vmn2r1 UTSW 3 64090108 missense possibly damaging 0.64
R6983:Vmn2r1 UTSW 3 64081697 missense probably benign
R7010:Vmn2r1 UTSW 3 64104725 missense probably benign 0.19
R7144:Vmn2r1 UTSW 3 64089941 missense probably damaging 1.00
R7341:Vmn2r1 UTSW 3 64105456 makesense probably null
R7510:Vmn2r1 UTSW 3 64086501 missense probably damaging 1.00
R7557:Vmn2r1 UTSW 3 64090054 missense probably damaging 0.99
R7895:Vmn2r1 UTSW 3 64089709 missense possibly damaging 0.90
R8108:Vmn2r1 UTSW 3 64103050 missense probably damaging 0.98
R8209:Vmn2r1 UTSW 3 64089778 missense possibly damaging 0.64
R8365:Vmn2r1 UTSW 3 64086613 missense possibly damaging 0.80
R8514:Vmn2r1 UTSW 3 64086521 missense probably benign 0.11
X0065:Vmn2r1 UTSW 3 64090257 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACTGCCAAAGTCATTGTGC -3'
(R):5'- TTCTCCTCTCCAGTGCAGAG -3'

Sequencing Primer
(F):5'- CTGCCAAAGTCATTGTGCTTTATAC -3'
(R):5'- GCTGATCAGACATGTCATACAGTCTG -3'
Posted On2021-01-18