Incidental Mutation 'R8554:Eln'
ID660017
Institutional Source Beutler Lab
Gene Symbol Eln
Ensembl Gene ENSMUSG00000029675
Gene Nameelastin
SynonymsE030024M20Rik, tropoelastin
Accession Numbers

Ncbi RefSeq: NM_007925.3; MGI:95317

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8554 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location134702593-134747323 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to C at 134710110 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015138] [ENSMUST00000201856]
Predicted Effect unknown
Transcript: ENSMUST00000015138
AA Change: Y672D
SMART Domains Protein: ENSMUSP00000015138
Gene: ENSMUSG00000029675
AA Change: Y672D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
low complexity region 224 264 N/A INTRINSIC
low complexity region 292 301 N/A INTRINSIC
low complexity region 312 446 N/A INTRINSIC
low complexity region 451 798 N/A INTRINSIC
low complexity region 818 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201856
SMART Domains Protein: ENSMUSP00000144555
Gene: ENSMUSG00000029675

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
SCOP:d1iq0a2 227 280 8e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 2153007
Lethality: 3- 4
FUNCTION: This gene encodes elastin, the extracellular matrix protein that forms a major structural component of several tissues including lungs and arterial walls. Cleavage of the signal peptide from the encoded precursor generates soluble tropoelastin which undergoes lysine-derived crosslinking to form elastin polymers. Mice lacking the encoded protein exhibit defective lung development, and die of an obstructive arterial disease resulting from subendothelial cell proliferation and reorganization of smooth muscle. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for null allele die in the early postnatal period of an obstructive arterial disease. They exhibit a decrease in arterial diameter due to subendothelial accumulation of arterial smooth muscle, and display defective terminal airway development resulting in emphysematous morphology. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,296,897 Y94N possibly damaging Het
Adtrp G A 13: 41,816,160 T89I possibly damaging Het
Apc T C 18: 34,312,946 V947A probably damaging Het
Apob A C 12: 7,987,830 K334N probably damaging Het
BC048403 T A 10: 121,740,055 I27N probably benign Het
Camk2d A T 3: 126,770,799 Q119L possibly damaging Het
Ccdc60 A T 5: 116,190,112 F98I probably damaging Het
Cd47 A G 16: 49,867,941 T22A probably benign Het
Crat A G 2: 30,410,023 V115A probably benign Het
Csmd3 T C 15: 47,644,142 M2992V probably benign Het
Dsg4 T A 18: 20,453,043 N263K probably damaging Het
Ep300 A G 15: 81,639,027 E1284G unknown Het
Fam193a T A 5: 34,475,771 M122K probably benign Het
Fam46a T C 9: 85,326,731 D13G possibly damaging Het
Fam57a A G 11: 76,205,418 H124R probably damaging Het
Fcgr1 A T 3: 96,292,472 W40R probably damaging Het
Gm3486 T A 14: 41,487,162 Q84L probably damaging Het
Gm9513 A G 9: 36,476,492 I25V probably benign Het
Golga2 G A 2: 32,293,345 D80N probably damaging Het
Isg20 T C 7: 78,916,677 Y125H probably benign Het
Kdf1 A G 4: 133,528,877 I302V probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Lrp1b T A 2: 41,344,483 Q1038L probably benign Het
March6 G A 15: 31,482,830 H476Y probably damaging Het
Myom1 A G 17: 71,036,453 E215G possibly damaging Het
Olfr1228 T C 2: 89,249,251 T148A possibly damaging Het
Olfr132 T A 17: 38,130,598 Q198L probably damaging Het
Olfr223 A T 11: 59,589,486 L201Q possibly damaging Het
Pdlim2 T A 14: 70,171,249 T173S probably benign Het
Pitpnb T C 5: 111,346,506 M74T probably benign Het
Pou2f2 C A 7: 25,115,556 probably benign Het
Rab35 A C 5: 115,645,631 probably null Het
Rasef A T 4: 73,727,607 D508E probably benign Het
Rev3l T C 10: 39,806,842 S319P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgl3 A G 9: 21,988,863 S44P probably benign Het
Rnf214 C A 9: 45,867,499 probably null Het
Rpsa T C 9: 120,129,251 V76A possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Senp7 T C 16: 56,158,610 V529A probably benign Het
Siglecg C T 7: 43,408,896 S69L probably benign Het
Sos1 G T 17: 80,398,413 T1243K probably damaging Het
Tmc2 A G 2: 130,264,164 T872A probably benign Het
Tnfrsf8 A C 4: 145,296,941 C107W probably damaging Het
Tnn T C 1: 160,110,416 Y913C probably damaging Het
Ttn T C 2: 76,738,032 T19179A probably damaging Het
Usp42 T A 5: 143,720,382 K294N probably damaging Het
Vmn1r123 T A 7: 21,163,046 C288S probably benign Het
Vmn1r29 T A 6: 58,308,206 *304K probably null Het
Vmn2r1 T C 3: 64,089,913 I330T probably damaging Het
Vmn2r16 A G 5: 109,364,131 I735V probably benign Het
Vmn2r65 T C 7: 84,946,752 I241M probably benign Het
Other mutations in Eln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Eln APN 5 134719040 intron probably benign
IGL01941:Eln APN 5 134718170 intron probably benign
IGL02508:Eln APN 5 134704568 utr 3 prime probably benign
IGL02654:Eln APN 5 134717054 intron probably benign
PIT4696001:Eln UTSW 5 134737178 missense unknown
R0036:Eln UTSW 5 134711060 critical splice donor site probably null
R0594:Eln UTSW 5 134712398 splice site probably benign
R0849:Eln UTSW 5 134707981 nonsense probably null
R1434:Eln UTSW 5 134729437 splice site probably benign
R1481:Eln UTSW 5 134706572 missense probably damaging 0.99
R1682:Eln UTSW 5 134703782 makesense probably null
R1741:Eln UTSW 5 134729184 missense unknown
R1926:Eln UTSW 5 134706567 nonsense probably null
R1983:Eln UTSW 5 134736340 splice site probably null
R2033:Eln UTSW 5 134710106 critical splice donor site probably null
R2259:Eln UTSW 5 134729654 missense unknown
R2260:Eln UTSW 5 134729654 missense unknown
R4450:Eln UTSW 5 134725781 intron probably benign
R6502:Eln UTSW 5 134725774 intron probably benign
R7249:Eln UTSW 5 134711081 utr 3 prime probably benign
R7479:Eln UTSW 5 134707575 missense unknown
R7819:Eln UTSW 5 134737181 missense unknown
R7855:Eln UTSW 5 134711081 utr 3 prime probably benign
R7873:Eln UTSW 5 134711187 missense unknown
R7923:Eln UTSW 5 134711081 utr 3 prime probably benign
R8047:Eln UTSW 5 134729149 small deletion probably benign
R8048:Eln UTSW 5 134729149 small deletion probably benign
R8073:Eln UTSW 5 134729149 small deletion probably benign
R8141:Eln UTSW 5 134729149 small deletion probably benign
R8144:Eln UTSW 5 134729149 small deletion probably benign
R8344:Eln UTSW 5 134728392 missense unknown
R8413:Eln UTSW 5 134726521 missense unknown
R8857:Eln UTSW 5 134711081 utr 3 prime probably benign
Z1177:Eln UTSW 5 134718026 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAGAAACTGTCAGGGTCGG -3'
(R):5'- CTGGCTAGAGTGCTATAGAGTTTC -3'

Sequencing Primer
(F):5'- TCTCCCTGTAGCCAAGGGTAAC -3'
(R):5'- CTAGAGTGCTATAGAGTTTCAGGGC -3'
Posted On2021-01-18