Incidental Mutation 'R8554:Siglecg'
ID 660022
Institutional Source Beutler Lab
Gene Symbol Siglecg
Ensembl Gene ENSMUSG00000030468
Gene Name sialic acid binding Ig-like lectin G
Synonyms A630096C01Rik, mSiglec-G
MMRRC Submission 068517-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.059) question?
Stock # R8554 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 43057623-43067773 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 43058320 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 69 (S69L)
Ref Sequence ENSEMBL: ENSMUSP00000005592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005592]
AlphaFold Q80ZE3
Predicted Effect probably benign
Transcript: ENSMUST00000005592
AA Change: S69L

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000005592
Gene: ENSMUSG00000030468
AA Change: S69L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IG 27 139 5.21e-2 SMART
IG_like 148 232 8.97e0 SMART
IGc2 262 325 3.38e-10 SMART
IGc2 366 427 8.26e-5 SMART
low complexity region 473 480 N/A INTRINSIC
transmembrane domain 545 564 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SIGLECs are members of the immunoglobulin superfamily that are expressed on the cell surface. Most SIGLECs have 1 or more cytoplasmic immune receptor tyrosine-based inhibitory motifs, or ITIMs. SIGLECs are typically expressed on cells of the innate immune system, with the exception of the B-cell expressed SIGLEC6 (MIM 604405).[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for a null allele exhibit increased B-1 cell numbers, increased IgM levels and IgM-producing plasma cells, and produce more IgM autoantibodies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Aopep T A 13: 63,444,711 (GRCm39) Y94N possibly damaging Het
Apc T C 18: 34,445,999 (GRCm39) V947A probably damaging Het
Apob A C 12: 8,037,830 (GRCm39) K334N probably damaging Het
Camk2d A T 3: 126,564,448 (GRCm39) Q119L possibly damaging Het
Ccdc60 A T 5: 116,328,171 (GRCm39) F98I probably damaging Het
Cd47 A G 16: 49,688,304 (GRCm39) T22A probably benign Het
Crat A G 2: 30,300,035 (GRCm39) V115A probably benign Het
Csmd3 T C 15: 47,507,538 (GRCm39) M2992V probably benign Het
Dsg4 T A 18: 20,586,100 (GRCm39) N263K probably damaging Het
Eln A C 5: 134,738,964 (GRCm39) probably benign Het
Ep300 A G 15: 81,523,228 (GRCm39) E1284G unknown Het
Fam193a T A 5: 34,633,115 (GRCm39) M122K probably benign Het
Fcgr1 A T 3: 96,199,788 (GRCm39) W40R probably damaging Het
Gm3486 T A 14: 41,209,119 (GRCm39) Q84L probably damaging Het
Golga2 G A 2: 32,183,357 (GRCm39) D80N probably damaging Het
Isg20 T C 7: 78,566,425 (GRCm39) Y125H probably benign Het
Kdf1 A G 4: 133,256,188 (GRCm39) I302V probably damaging Het
Kics2 T A 10: 121,575,960 (GRCm39) I27N probably benign Het
Krt33a T A 11: 99,903,209 (GRCm39) T278S possibly damaging Het
Lrp1b T A 2: 41,234,495 (GRCm39) Q1038L probably benign Het
Marchf6 G A 15: 31,482,976 (GRCm39) H476Y probably damaging Het
Myom1 A G 17: 71,343,448 (GRCm39) E215G possibly damaging Het
Or2aa1 A T 11: 59,480,312 (GRCm39) L201Q possibly damaging Het
Or2h15 T A 17: 38,441,489 (GRCm39) Q198L probably damaging Het
Or4c122 T C 2: 89,079,595 (GRCm39) T148A possibly damaging Het
Pate11 A G 9: 36,387,788 (GRCm39) I25V probably benign Het
Pdlim2 T A 14: 70,408,698 (GRCm39) T173S probably benign Het
Pitpnb T C 5: 111,494,372 (GRCm39) M74T probably benign Het
Pou2f2 C A 7: 24,814,981 (GRCm39) probably benign Het
Rab35 A C 5: 115,783,690 (GRCm39) probably null Het
Rasef A T 4: 73,645,844 (GRCm39) D508E probably benign Het
Rev3l T C 10: 39,682,838 (GRCm39) S319P probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rgl3 A G 9: 21,900,159 (GRCm39) S44P probably benign Het
Rnf214 C A 9: 45,778,797 (GRCm39) probably null Het
Rpsa T C 9: 119,958,317 (GRCm39) V76A possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,130 (GRCm39) probably benign Het
Senp7 T C 16: 55,978,973 (GRCm39) V529A probably benign Het
Sos1 G T 17: 80,705,842 (GRCm39) T1243K probably damaging Het
Tent5a T C 9: 85,208,784 (GRCm39) D13G possibly damaging Het
Tlcd3a A G 11: 76,096,244 (GRCm39) H124R probably damaging Het
Tmc2 A G 2: 130,106,084 (GRCm39) T872A probably benign Het
Tnfrsf8 A C 4: 145,023,511 (GRCm39) C107W probably damaging Het
Tnn T C 1: 159,937,986 (GRCm39) Y913C probably damaging Het
Ttn T C 2: 76,568,376 (GRCm39) T19179A probably damaging Het
Usp42 T A 5: 143,706,137 (GRCm39) K294N probably damaging Het
Vmn1r123 T A 7: 20,896,971 (GRCm39) C288S probably benign Het
Vmn1r29 T A 6: 58,285,191 (GRCm39) *304K probably null Het
Vmn2r1 T C 3: 63,997,334 (GRCm39) I330T probably damaging Het
Vmn2r16 A G 5: 109,511,997 (GRCm39) I735V probably benign Het
Vmn2r65 T C 7: 84,595,960 (GRCm39) I241M probably benign Het
Other mutations in Siglecg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Siglecg APN 7 43,058,481 (GRCm39) missense possibly damaging 0.64
IGL00556:Siglecg APN 7 43,061,219 (GRCm39) missense probably benign 0.02
IGL01806:Siglecg APN 7 43,060,888 (GRCm39) splice site probably null
IGL01947:Siglecg APN 7 43,058,187 (GRCm39) missense probably benign 0.43
IGL02257:Siglecg APN 7 43,061,328 (GRCm39) missense probably benign 0.00
IGL02410:Siglecg APN 7 43,058,253 (GRCm39) missense probably damaging 0.99
IGL02454:Siglecg APN 7 43,058,319 (GRCm39) missense probably benign 0.00
Chamonix UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
Dollywood UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
glowworm UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
Montblanc UTSW 7 43,060,810 (GRCm39) intron probably benign
Shenandoah UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
shenandoah2 UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
Sherando UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
Smokies UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
IGL02988:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 1.00
R0134:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0225:Siglecg UTSW 7 43,060,595 (GRCm39) missense probably damaging 1.00
R0480:Siglecg UTSW 7 43,060,550 (GRCm39) missense probably benign 0.42
R1538:Siglecg UTSW 7 43,067,313 (GRCm39) missense possibly damaging 0.53
R1681:Siglecg UTSW 7 43,058,365 (GRCm39) missense probably benign 0.17
R2358:Siglecg UTSW 7 43,058,846 (GRCm39) missense possibly damaging 0.91
R4428:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4429:Siglecg UTSW 7 43,067,350 (GRCm39) missense possibly damaging 0.84
R4736:Siglecg UTSW 7 43,067,332 (GRCm39) missense probably benign 0.03
R4754:Siglecg UTSW 7 43,061,295 (GRCm39) intron probably benign
R5017:Siglecg UTSW 7 43,060,810 (GRCm39) intron probably benign
R5713:Siglecg UTSW 7 43,058,226 (GRCm39) missense probably damaging 0.99
R5777:Siglecg UTSW 7 43,058,837 (GRCm39) missense possibly damaging 0.80
R5892:Siglecg UTSW 7 43,061,628 (GRCm39) intron probably benign
R6153:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6154:Siglecg UTSW 7 43,061,441 (GRCm39) missense possibly damaging 0.82
R6331:Siglecg UTSW 7 43,058,178 (GRCm39) missense possibly damaging 0.83
R6562:Siglecg UTSW 7 43,058,481 (GRCm39) missense possibly damaging 0.64
R6749:Siglecg UTSW 7 43,058,403 (GRCm39) missense probably benign 0.00
R7066:Siglecg UTSW 7 43,061,166 (GRCm39) missense probably benign 0.40
R7884:Siglecg UTSW 7 43,058,703 (GRCm39) missense probably benign 0.02
R8275:Siglecg UTSW 7 43,061,892 (GRCm39) missense probably benign
R8846:Siglecg UTSW 7 43,061,942 (GRCm39) missense probably benign 0.02
R8873:Siglecg UTSW 7 43,067,448 (GRCm39) missense probably benign 0.00
R8887:Siglecg UTSW 7 43,058,008 (GRCm39) missense probably benign 0.18
R9012:Siglecg UTSW 7 43,060,523 (GRCm39) missense probably damaging 1.00
R9032:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9048:Siglecg UTSW 7 43,058,003 (GRCm39) missense probably benign 0.04
R9085:Siglecg UTSW 7 43,061,049 (GRCm39) missense probably benign 0.24
R9313:Siglecg UTSW 7 43,061,856 (GRCm39) missense probably benign 0.03
R9320:Siglecg UTSW 7 43,058,853 (GRCm39) missense probably benign 0.33
R9745:Siglecg UTSW 7 43,067,476 (GRCm39) missense probably damaging 0.98
RF006:Siglecg UTSW 7 43,058,288 (GRCm39) nonsense probably null
Z1177:Siglecg UTSW 7 43,061,446 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCTTATGCCTCTGTCTCCG -3'
(R):5'- ACCTTCCACTTGTAGCCTGAAC -3'

Sequencing Primer
(F):5'- GACAGGGCCTCAAGGTCAG -3'
(R):5'- GTAGCCTGAACTCCTCCTTGAAAC -3'
Posted On 2021-01-18