Incidental Mutation 'R8554:Rpsa'
ID 660030
Institutional Source Beutler Lab
Gene Symbol Rpsa
Ensembl Gene ENSMUSG00000032518
Gene Name ribosomal protein SA
Synonyms P40-3, Lamrl1, Lamr1, Lamr, P40-8, 67lr
MMRRC Submission 068517-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8554 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 119956832-119961435 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119958317 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 76 (V76A)
Ref Sequence ENSEMBL: ENSMUSP00000150804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035105] [ENSMUST00000035106] [ENSMUST00000217317] [ENSMUST00000217352] [ENSMUST00000217356]
AlphaFold P14206
Predicted Effect possibly damaging
Transcript: ENSMUST00000035105
AA Change: V76A

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035105
Gene: ENSMUSG00000032518
AA Change: V76A

DomainStartEndE-ValueType
Pfam:Ribosomal_S2 18 118 3.7e-12 PFAM
Pfam:Ribosomal_S2 111 184 6.5e-14 PFAM
Pfam:40S_SA_C 202 295 2.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000035106
SMART Domains Protein: ENSMUSP00000035106
Gene: ENSMUSG00000032519

DomainStartEndE-ValueType
Pfam:Mito_carr 44 139 4.1e-23 PFAM
Pfam:Mito_carr 139 229 2.5e-19 PFAM
Pfam:Mito_carr 237 326 4.8e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217317
AA Change: V76A

PolyPhen 2 Score 0.776 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000217352
Predicted Effect possibly damaging
Transcript: ENSMUST00000217356
AA Change: V76A

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Many of the effects of laminin are mediated through interactions with cell surface receptors. These receptors include members of the integrin family, as well as non-integrin laminin-binding proteins. This gene encodes a high-affinity, non-integrin family, laminin receptor 1. This receptor has been variously called 67 kD laminin receptor, 37 kD laminin receptor precursor (37LRP) and p40 ribosome-associated protein. The amino acid sequence of laminin receptor 1 is highly conserved through evolution, suggesting a key biological function. It has been observed that the level of the laminin receptor transcript is higher in colon carcinoma tissue and lung cancer cell line than their normal counterparts. Also, there is a correlation between the upregulation of this polypeptide in cancer cells and their invasive and metastatic phenotype. Multiple copies of this gene exist, however, most of them are pseudogenes thought to have arisen from retropositional events. Two alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Spontaneous mutants show right ventricular cardiomyocyte degeneration and higher susceptibility to arrhythmia. Homozygous null mice fail to develop past E3.5; heterozygotes show craniofacial defects, low mean corpuscular hemoglobin concentration and reduced insulin content in pancreatic islet cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Aopep T A 13: 63,444,711 (GRCm39) Y94N possibly damaging Het
Apc T C 18: 34,445,999 (GRCm39) V947A probably damaging Het
Apob A C 12: 8,037,830 (GRCm39) K334N probably damaging Het
Camk2d A T 3: 126,564,448 (GRCm39) Q119L possibly damaging Het
Ccdc60 A T 5: 116,328,171 (GRCm39) F98I probably damaging Het
Cd47 A G 16: 49,688,304 (GRCm39) T22A probably benign Het
Crat A G 2: 30,300,035 (GRCm39) V115A probably benign Het
Csmd3 T C 15: 47,507,538 (GRCm39) M2992V probably benign Het
Dsg4 T A 18: 20,586,100 (GRCm39) N263K probably damaging Het
Eln A C 5: 134,738,964 (GRCm39) probably benign Het
Ep300 A G 15: 81,523,228 (GRCm39) E1284G unknown Het
Fam193a T A 5: 34,633,115 (GRCm39) M122K probably benign Het
Fcgr1 A T 3: 96,199,788 (GRCm39) W40R probably damaging Het
Gm3486 T A 14: 41,209,119 (GRCm39) Q84L probably damaging Het
Golga2 G A 2: 32,183,357 (GRCm39) D80N probably damaging Het
Isg20 T C 7: 78,566,425 (GRCm39) Y125H probably benign Het
Kdf1 A G 4: 133,256,188 (GRCm39) I302V probably damaging Het
Kics2 T A 10: 121,575,960 (GRCm39) I27N probably benign Het
Krt33a T A 11: 99,903,209 (GRCm39) T278S possibly damaging Het
Lrp1b T A 2: 41,234,495 (GRCm39) Q1038L probably benign Het
Marchf6 G A 15: 31,482,976 (GRCm39) H476Y probably damaging Het
Myom1 A G 17: 71,343,448 (GRCm39) E215G possibly damaging Het
Or2aa1 A T 11: 59,480,312 (GRCm39) L201Q possibly damaging Het
Or2h15 T A 17: 38,441,489 (GRCm39) Q198L probably damaging Het
Or4c122 T C 2: 89,079,595 (GRCm39) T148A possibly damaging Het
Pate11 A G 9: 36,387,788 (GRCm39) I25V probably benign Het
Pdlim2 T A 14: 70,408,698 (GRCm39) T173S probably benign Het
Pitpnb T C 5: 111,494,372 (GRCm39) M74T probably benign Het
Pou2f2 C A 7: 24,814,981 (GRCm39) probably benign Het
Rab35 A C 5: 115,783,690 (GRCm39) probably null Het
Rasef A T 4: 73,645,844 (GRCm39) D508E probably benign Het
Rev3l T C 10: 39,682,838 (GRCm39) S319P probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rgl3 A G 9: 21,900,159 (GRCm39) S44P probably benign Het
Rnf214 C A 9: 45,778,797 (GRCm39) probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,130 (GRCm39) probably benign Het
Senp7 T C 16: 55,978,973 (GRCm39) V529A probably benign Het
Siglecg C T 7: 43,058,320 (GRCm39) S69L probably benign Het
Sos1 G T 17: 80,705,842 (GRCm39) T1243K probably damaging Het
Tent5a T C 9: 85,208,784 (GRCm39) D13G possibly damaging Het
Tlcd3a A G 11: 76,096,244 (GRCm39) H124R probably damaging Het
Tmc2 A G 2: 130,106,084 (GRCm39) T872A probably benign Het
Tnfrsf8 A C 4: 145,023,511 (GRCm39) C107W probably damaging Het
Tnn T C 1: 159,937,986 (GRCm39) Y913C probably damaging Het
Ttn T C 2: 76,568,376 (GRCm39) T19179A probably damaging Het
Usp42 T A 5: 143,706,137 (GRCm39) K294N probably damaging Het
Vmn1r123 T A 7: 20,896,971 (GRCm39) C288S probably benign Het
Vmn1r29 T A 6: 58,285,191 (GRCm39) *304K probably null Het
Vmn2r1 T C 3: 63,997,334 (GRCm39) I330T probably damaging Het
Vmn2r16 A G 5: 109,511,997 (GRCm39) I735V probably benign Het
Vmn2r65 T C 7: 84,595,960 (GRCm39) I241M probably benign Het
Other mutations in Rpsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02503:Rpsa APN 9 119,957,659 (GRCm39) missense possibly damaging 0.57
IGL02522:Rpsa APN 9 119,960,121 (GRCm39) missense possibly damaging 0.47
PIT4515001:Rpsa UTSW 9 119,960,214 (GRCm39) missense probably benign 0.04
R0281:Rpsa UTSW 9 119,960,069 (GRCm39) missense possibly damaging 0.81
R1511:Rpsa UTSW 9 119,960,066 (GRCm39) missense possibly damaging 0.64
R4942:Rpsa UTSW 9 119,960,129 (GRCm39) missense probably benign 0.04
R5814:Rpsa UTSW 9 119,957,551 (GRCm39) start gained probably benign
R6122:Rpsa UTSW 9 119,960,102 (GRCm39) missense probably benign 0.01
R6545:Rpsa UTSW 9 119,959,323 (GRCm39) missense probably benign 0.11
R7225:Rpsa UTSW 9 119,960,222 (GRCm39) missense probably benign 0.00
RF012:Rpsa UTSW 9 119,960,105 (GRCm39) missense probably benign 0.01
Z1176:Rpsa UTSW 9 119,959,412 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACACCCACTTTAAACTACTTG -3'
(R):5'- CACAAAGCTCTGTTTGCCACC -3'

Sequencing Primer
(F):5'- TCAGGAGTCTGATCAGCCAG -3'
(R):5'- TCCACAGGACTCTGAGAAGTCG -3'
Posted On 2021-01-18