Incidental Mutation 'R8554:Cd47'
ID660044
Institutional Source Beutler Lab
Gene Symbol Cd47
Ensembl Gene ENSMUSG00000055447
Gene NameCD47 antigen (Rh-related antigen, integrin-associated signal transducer)
SynonymsB430305P08Rik, 9130415E20Rik, integrin-associated protein, Itgp, IAP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8554 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location49800533-49915010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49867941 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 22 (T22A)
Ref Sequence ENSEMBL: ENSMUSP00000154914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084838] [ENSMUST00000114496] [ENSMUST00000229101] [ENSMUST00000229104] [ENSMUST00000229206] [ENSMUST00000229640] [ENSMUST00000230281] [ENSMUST00000230641] [ENSMUST00000230836]
Predicted Effect probably benign
Transcript: ENSMUST00000084838
AA Change: T75A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099853
Gene: ENSMUSG00000055447
AA Change: T75A

DomainStartEndE-ValueType
Pfam:V-set_CD47 8 137 2.2e-46 PFAM
Pfam:CD47 163 317 4.7e-62 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000110140
Gene: ENSMUSG00000055447
AA Change: T22A

DomainStartEndE-ValueType
Pfam:V-set_CD47 1 41 1.8e-15 PFAM
Pfam:CD47 42 199 6.8e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229101
AA Change: T22A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000229104
AA Change: T22A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000229206
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000230281
AA Change: T22A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000230641
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000230836
AA Change: T75A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. The encoded protein is also a receptor for the C-terminal cell binding domain of thrombospondin, and it may play a role in membrane transport and signal transduction. This gene has broad tissue distribution, and is reduced in expression on Rh erythrocytes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in a reduced CD3+ fraction of peripheral lymphocytes and inability to clear infection by E.coli. Mutant animals are otherwise normal in appearance, survival, and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,296,897 Y94N possibly damaging Het
Adtrp G A 13: 41,816,160 T89I possibly damaging Het
Apc T C 18: 34,312,946 V947A probably damaging Het
Apob A C 12: 7,987,830 K334N probably damaging Het
BC048403 T A 10: 121,740,055 I27N probably benign Het
Camk2d A T 3: 126,770,799 Q119L possibly damaging Het
Ccdc60 A T 5: 116,190,112 F98I probably damaging Het
Crat A G 2: 30,410,023 V115A probably benign Het
Csmd3 T C 15: 47,644,142 M2992V probably benign Het
Dsg4 T A 18: 20,453,043 N263K probably damaging Het
Eln A C 5: 134,710,110 probably benign Het
Ep300 A G 15: 81,639,027 E1284G unknown Het
Fam193a T A 5: 34,475,771 M122K probably benign Het
Fam46a T C 9: 85,326,731 D13G possibly damaging Het
Fam57a A G 11: 76,205,418 H124R probably damaging Het
Fcgr1 A T 3: 96,292,472 W40R probably damaging Het
Gm3486 T A 14: 41,487,162 Q84L probably damaging Het
Gm9513 A G 9: 36,476,492 I25V probably benign Het
Golga2 G A 2: 32,293,345 D80N probably damaging Het
Isg20 T C 7: 78,916,677 Y125H probably benign Het
Kdf1 A G 4: 133,528,877 I302V probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Lrp1b T A 2: 41,344,483 Q1038L probably benign Het
March6 G A 15: 31,482,830 H476Y probably damaging Het
Myom1 A G 17: 71,036,453 E215G possibly damaging Het
Olfr1228 T C 2: 89,249,251 T148A possibly damaging Het
Olfr132 T A 17: 38,130,598 Q198L probably damaging Het
Olfr223 A T 11: 59,589,486 L201Q possibly damaging Het
Pdlim2 T A 14: 70,171,249 T173S probably benign Het
Pitpnb T C 5: 111,346,506 M74T probably benign Het
Pou2f2 C A 7: 25,115,556 probably benign Het
Rab35 A C 5: 115,645,631 probably null Het
Rasef A T 4: 73,727,607 D508E probably benign Het
Rev3l T C 10: 39,806,842 S319P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgl3 A G 9: 21,988,863 S44P probably benign Het
Rnf214 C A 9: 45,867,499 probably null Het
Rpsa T C 9: 120,129,251 V76A possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Senp7 T C 16: 56,158,610 V529A probably benign Het
Siglecg C T 7: 43,408,896 S69L probably benign Het
Sos1 G T 17: 80,398,413 T1243K probably damaging Het
Tmc2 A G 2: 130,264,164 T872A probably benign Het
Tnfrsf8 A C 4: 145,296,941 C107W probably damaging Het
Tnn T C 1: 160,110,416 Y913C probably damaging Het
Ttn T C 2: 76,738,032 T19179A probably damaging Het
Usp42 T A 5: 143,720,382 K294N probably damaging Het
Vmn1r123 T A 7: 21,163,046 C288S probably benign Het
Vmn1r29 T A 6: 58,308,206 *304K probably null Het
Vmn2r1 T C 3: 64,089,913 I330T probably damaging Het
Vmn2r16 A G 5: 109,364,131 I735V probably benign Het
Vmn2r65 T C 7: 84,946,752 I241M probably benign Het
Other mutations in Cd47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03253:Cd47 APN 16 49894198 missense probably benign 0.11
R0675:Cd47 UTSW 16 49906799 missense possibly damaging 0.61
R1374:Cd47 UTSW 16 49894180 missense probably damaging 1.00
R1651:Cd47 UTSW 16 49894228 missense possibly damaging 0.93
R1712:Cd47 UTSW 16 49894180 missense probably damaging 1.00
R1803:Cd47 UTSW 16 49867806 missense possibly damaging 0.87
R3720:Cd47 UTSW 16 49867842 missense probably benign 0.09
R3722:Cd47 UTSW 16 49867842 missense probably benign 0.09
R4525:Cd47 UTSW 16 49867792 missense probably benign 0.15
R5366:Cd47 UTSW 16 49896373 missense probably damaging 1.00
R6878:Cd47 UTSW 16 49910869 missense possibly damaging 0.82
R7219:Cd47 UTSW 16 49908077 missense possibly damaging 0.50
R7470:Cd47 UTSW 16 49884222 missense
R8068:Cd47 UTSW 16 49895416 missense
R8772:Cd47 UTSW 16 49884212 missense
Predicted Primers PCR Primer
(F):5'- TTCCAGGTTCAGCTCAACTACTG -3'
(R):5'- GGTTCCACCTTACAGCACTC -3'

Sequencing Primer
(F):5'- CAGGTTCAGCTCAACTACTGTTTAG -3'
(R):5'- GGCAAACTGTGTCACTTACCCG -3'
Posted On2021-01-18