Incidental Mutation 'R8554:Myom1'
ID660048
Institutional Source Beutler Lab
Gene Symbol Myom1
Ensembl Gene ENSMUSG00000024049
Gene Namemyomesin 1
Synonymsskelemin, D430047A17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8554 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location71019521-71126856 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 71036453 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 215 (E215G)
Ref Sequence ENSEMBL: ENSMUSP00000072945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024847] [ENSMUST00000073211] [ENSMUST00000179759]
PDB Structure Skelemin Immunoglobulin C2 like domain 4 [SOLUTION NMR]
Skelemin Association with alfa2b,betta3 Integrin: A Structural Model [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024847
AA Change: E215G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000024847
Gene: ENSMUSG00000024049
AA Change: E215G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000073211
AA Change: E215G

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072945
Gene: ENSMUSG00000024049
AA Change: E215G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
low complexity region 857 870 N/A INTRINSIC
FN3 916 1002 4.99e-11 SMART
FN3 1021 1106 2.04e-16 SMART
IG 1123 1208 3.1e0 SMART
IG_like 1231 1317 1.34e1 SMART
IG_like 1351 1417 4.79e0 SMART
IG_like 1454 1531 1.54e2 SMART
IGc2 1567 1635 2.05e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179759
AA Change: E215G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000136266
Gene: ENSMUSG00000024049
AA Change: E215G

DomainStartEndE-ValueType
low complexity region 62 94 N/A INTRINSIC
low complexity region 188 210 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
IG 264 351 1.16e-8 SMART
IG 397 480 5.84e-5 SMART
FN3 490 573 4.48e-13 SMART
FN3 618 701 1.61e-14 SMART
FN3 719 800 1.43e-11 SMART
FN3 818 904 4.99e-11 SMART
FN3 923 1008 2.04e-16 SMART
IG 1025 1110 3.1e0 SMART
IG_like 1133 1219 1.34e1 SMART
IG_like 1253 1319 4.79e0 SMART
IG_like 1356 1433 1.54e2 SMART
IGc2 1469 1537 2.05e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The giant protein titin, together with its associated proteins, interconnects the major structure of sarcomeres, the M bands and Z discs. The C-terminal end of the titin string extends into the M line, where it binds tightly to M-band constituents of apparent molecular masses of 190 kD (myomesin 1) and 165 kD (myomesin 2). This protein, myomesin 1, like myomesin 2, titin, and other myofibrillar proteins contains structural modules with strong homology to either fibronectin type III (motif I) or immunoglobulin C2 (motif II) domains. Myomesin 1 and myomesin 2 each have a unique N-terminal region followed by 12 modules of motif I or motif II, in the arrangement II-II-I-I-I-I-I-II-II-II-II-II. The two proteins share 50% sequence identity in this repeat-containing region. The head structure formed by these 2 proteins on one end of the titin string extends into the center of the M band. The integrating structure of the sarcomere arises from muscle-specific members of the superfamily of immunoglobulin-like proteins. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,296,897 Y94N possibly damaging Het
Adtrp G A 13: 41,816,160 T89I possibly damaging Het
Apc T C 18: 34,312,946 V947A probably damaging Het
Apob A C 12: 7,987,830 K334N probably damaging Het
BC048403 T A 10: 121,740,055 I27N probably benign Het
Camk2d A T 3: 126,770,799 Q119L possibly damaging Het
Ccdc60 A T 5: 116,190,112 F98I probably damaging Het
Cd47 A G 16: 49,867,941 T22A probably benign Het
Crat A G 2: 30,410,023 V115A probably benign Het
Csmd3 T C 15: 47,644,142 M2992V probably benign Het
Dsg4 T A 18: 20,453,043 N263K probably damaging Het
Eln A C 5: 134,710,110 probably benign Het
Ep300 A G 15: 81,639,027 E1284G unknown Het
Fam193a T A 5: 34,475,771 M122K probably benign Het
Fam46a T C 9: 85,326,731 D13G possibly damaging Het
Fam57a A G 11: 76,205,418 H124R probably damaging Het
Fcgr1 A T 3: 96,292,472 W40R probably damaging Het
Gm3486 T A 14: 41,487,162 Q84L probably damaging Het
Gm9513 A G 9: 36,476,492 I25V probably benign Het
Golga2 G A 2: 32,293,345 D80N probably damaging Het
Isg20 T C 7: 78,916,677 Y125H probably benign Het
Kdf1 A G 4: 133,528,877 I302V probably damaging Het
Krt33a T A 11: 100,012,383 T278S possibly damaging Het
Lrp1b T A 2: 41,344,483 Q1038L probably benign Het
March6 G A 15: 31,482,830 H476Y probably damaging Het
Olfr1228 T C 2: 89,249,251 T148A possibly damaging Het
Olfr132 T A 17: 38,130,598 Q198L probably damaging Het
Olfr223 A T 11: 59,589,486 L201Q possibly damaging Het
Pdlim2 T A 14: 70,171,249 T173S probably benign Het
Pitpnb T C 5: 111,346,506 M74T probably benign Het
Pou2f2 C A 7: 25,115,556 probably benign Het
Rab35 A C 5: 115,645,631 probably null Het
Rasef A T 4: 73,727,607 D508E probably benign Het
Rev3l T C 10: 39,806,842 S319P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rgl3 A G 9: 21,988,863 S44P probably benign Het
Rnf214 C A 9: 45,867,499 probably null Het
Rpsa T C 9: 120,129,251 V76A possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,923 probably benign Het
Senp7 T C 16: 56,158,610 V529A probably benign Het
Siglecg C T 7: 43,408,896 S69L probably benign Het
Sos1 G T 17: 80,398,413 T1243K probably damaging Het
Tmc2 A G 2: 130,264,164 T872A probably benign Het
Tnfrsf8 A C 4: 145,296,941 C107W probably damaging Het
Tnn T C 1: 160,110,416 Y913C probably damaging Het
Ttn T C 2: 76,738,032 T19179A probably damaging Het
Usp42 T A 5: 143,720,382 K294N probably damaging Het
Vmn1r123 T A 7: 21,163,046 C288S probably benign Het
Vmn1r29 T A 6: 58,308,206 *304K probably null Het
Vmn2r1 T C 3: 64,089,913 I330T probably damaging Het
Vmn2r16 A G 5: 109,364,131 I735V probably benign Het
Vmn2r65 T C 7: 84,946,752 I241M probably benign Het
Other mutations in Myom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Myom1 APN 17 71126098 missense probably damaging 1.00
IGL00845:Myom1 APN 17 71084429 missense probably damaging 1.00
IGL00904:Myom1 APN 17 71099949 splice site probably benign
IGL00928:Myom1 APN 17 71089913 missense probably damaging 1.00
IGL01025:Myom1 APN 17 71077917 missense probably damaging 1.00
IGL01548:Myom1 APN 17 71101220 splice site probably benign
IGL01588:Myom1 APN 17 71117437 missense possibly damaging 0.94
IGL01614:Myom1 APN 17 71126178 missense possibly damaging 0.46
IGL01618:Myom1 APN 17 71099993 missense possibly damaging 0.87
IGL01619:Myom1 APN 17 71044476 splice site probably benign
IGL01766:Myom1 APN 17 71077288 missense probably damaging 1.00
IGL02105:Myom1 APN 17 71047716 splice site probably benign
IGL02122:Myom1 APN 17 71092137 missense probably damaging 1.00
IGL02184:Myom1 APN 17 71072137 missense possibly damaging 0.93
IGL02260:Myom1 APN 17 71108315 nonsense probably null
IGL02486:Myom1 APN 17 71099944 splice site probably benign
IGL02501:Myom1 APN 17 71072081 critical splice acceptor site probably null
IGL02642:Myom1 APN 17 71101098 missense possibly damaging 0.90
IGL02677:Myom1 APN 17 71084349 missense probably damaging 1.00
IGL02719:Myom1 APN 17 71106354 splice site probably benign
IGL02945:Myom1 APN 17 71092093 splice site probably benign
IGL03086:Myom1 APN 17 71108671 missense probably damaging 1.00
IGL03218:Myom1 APN 17 71084316 missense possibly damaging 0.46
R0107:Myom1 UTSW 17 71077365 missense probably damaging 1.00
R0130:Myom1 UTSW 17 71045755 missense probably damaging 0.98
R0133:Myom1 UTSW 17 71047787 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0206:Myom1 UTSW 17 71037297 missense probably damaging 1.00
R0352:Myom1 UTSW 17 71045749 missense possibly damaging 0.72
R0396:Myom1 UTSW 17 71034693 missense probably damaging 1.00
R0496:Myom1 UTSW 17 71084306 missense probably damaging 1.00
R0506:Myom1 UTSW 17 71092220 splice site probably benign
R0511:Myom1 UTSW 17 71084317 missense probably benign 0.22
R0600:Myom1 UTSW 17 71120648 missense possibly damaging 0.48
R0699:Myom1 UTSW 17 71067313 missense probably damaging 0.98
R0791:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0792:Myom1 UTSW 17 71121136 missense probably damaging 1.00
R0963:Myom1 UTSW 17 71077767 missense possibly damaging 0.74
R1324:Myom1 UTSW 17 71052719 missense probably damaging 0.98
R2102:Myom1 UTSW 17 71101029 missense probably damaging 1.00
R2158:Myom1 UTSW 17 71064597 missense possibly damaging 0.83
R2336:Myom1 UTSW 17 71023194 missense possibly damaging 0.53
R2351:Myom1 UTSW 17 71034579 missense probably damaging 0.98
R2442:Myom1 UTSW 17 71110735 missense probably damaging 1.00
R2483:Myom1 UTSW 17 71077812 missense probably damaging 1.00
R2892:Myom1 UTSW 17 71034653 missense probably damaging 1.00
R2897:Myom1 UTSW 17 71101220 splice site probably benign
R3440:Myom1 UTSW 17 71045663 splice site probably null
R3842:Myom1 UTSW 17 71045624 missense probably damaging 1.00
R4249:Myom1 UTSW 17 71092140 missense probably damaging 1.00
R4329:Myom1 UTSW 17 71036353 missense probably damaging 1.00
R4594:Myom1 UTSW 17 71100074 missense possibly damaging 0.73
R4873:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4875:Myom1 UTSW 17 71072119 missense probably damaging 1.00
R4876:Myom1 UTSW 17 71077410 missense probably damaging 1.00
R5171:Myom1 UTSW 17 71099972 missense possibly damaging 0.94
R5540:Myom1 UTSW 17 71109787 missense probably damaging 1.00
R5882:Myom1 UTSW 17 71110722 missense probably damaging 1.00
R5978:Myom1 UTSW 17 71117443 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6039:Myom1 UTSW 17 71110751 missense probably damaging 1.00
R6155:Myom1 UTSW 17 71108695 critical splice donor site probably null
R6261:Myom1 UTSW 17 71126137 missense probably damaging 1.00
R6284:Myom1 UTSW 17 71022892 nonsense probably null
R6313:Myom1 UTSW 17 71082488 missense probably benign
R6369:Myom1 UTSW 17 71101076 missense probably damaging 1.00
R6545:Myom1 UTSW 17 71082305 missense probably benign 0.00
R6738:Myom1 UTSW 17 71100398 splice site probably null
R6933:Myom1 UTSW 17 71052671 missense probably damaging 1.00
R7168:Myom1 UTSW 17 71089947 missense probably benign 0.00
R7286:Myom1 UTSW 17 71045549 missense possibly damaging 0.90
R7315:Myom1 UTSW 17 71080897 critical splice donor site probably null
R7672:Myom1 UTSW 17 71084240 missense possibly damaging 0.92
R7789:Myom1 UTSW 17 71117436 missense probably benign 0.03
R7898:Myom1 UTSW 17 71045752 missense probably benign 0.25
R8008:Myom1 UTSW 17 71100062 missense probably benign 0.30
R8152:Myom1 UTSW 17 71084295 missense probably damaging 0.96
X0019:Myom1 UTSW 17 71100071 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATCTTGTCGTTGTCACACCG -3'
(R):5'- TCGTTCTGCCCTTGAGACAAAC -3'

Sequencing Primer
(F):5'- ACTGTTTCAGGCAAGTGCAC -3'
(R):5'- GTTCTGCCCTTGAGACAAACTAGTC -3'
Posted On2021-01-18