Incidental Mutation 'R8554:Dsg4'
ID 660050
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Name desmoglein 4
Synonyms CDHF13, lah
MMRRC Submission 068517-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.626) question?
Stock # R8554 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20569232-20604878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20586100 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 263 (N263K)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
AlphaFold Q7TMD7
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: N263K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: N263K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adtrp G A 13: 41,969,636 (GRCm39) T89I possibly damaging Het
Aopep T A 13: 63,444,711 (GRCm39) Y94N possibly damaging Het
Apc T C 18: 34,445,999 (GRCm39) V947A probably damaging Het
Apob A C 12: 8,037,830 (GRCm39) K334N probably damaging Het
Camk2d A T 3: 126,564,448 (GRCm39) Q119L possibly damaging Het
Ccdc60 A T 5: 116,328,171 (GRCm39) F98I probably damaging Het
Cd47 A G 16: 49,688,304 (GRCm39) T22A probably benign Het
Crat A G 2: 30,300,035 (GRCm39) V115A probably benign Het
Csmd3 T C 15: 47,507,538 (GRCm39) M2992V probably benign Het
Eln A C 5: 134,738,964 (GRCm39) probably benign Het
Ep300 A G 15: 81,523,228 (GRCm39) E1284G unknown Het
Fam193a T A 5: 34,633,115 (GRCm39) M122K probably benign Het
Fcgr1 A T 3: 96,199,788 (GRCm39) W40R probably damaging Het
Gm3486 T A 14: 41,209,119 (GRCm39) Q84L probably damaging Het
Golga2 G A 2: 32,183,357 (GRCm39) D80N probably damaging Het
Isg20 T C 7: 78,566,425 (GRCm39) Y125H probably benign Het
Kdf1 A G 4: 133,256,188 (GRCm39) I302V probably damaging Het
Kics2 T A 10: 121,575,960 (GRCm39) I27N probably benign Het
Krt33a T A 11: 99,903,209 (GRCm39) T278S possibly damaging Het
Lrp1b T A 2: 41,234,495 (GRCm39) Q1038L probably benign Het
Marchf6 G A 15: 31,482,976 (GRCm39) H476Y probably damaging Het
Myom1 A G 17: 71,343,448 (GRCm39) E215G possibly damaging Het
Or2aa1 A T 11: 59,480,312 (GRCm39) L201Q possibly damaging Het
Or2h15 T A 17: 38,441,489 (GRCm39) Q198L probably damaging Het
Or4c122 T C 2: 89,079,595 (GRCm39) T148A possibly damaging Het
Pate11 A G 9: 36,387,788 (GRCm39) I25V probably benign Het
Pdlim2 T A 14: 70,408,698 (GRCm39) T173S probably benign Het
Pitpnb T C 5: 111,494,372 (GRCm39) M74T probably benign Het
Pou2f2 C A 7: 24,814,981 (GRCm39) probably benign Het
Rab35 A C 5: 115,783,690 (GRCm39) probably null Het
Rasef A T 4: 73,645,844 (GRCm39) D508E probably benign Het
Rev3l T C 10: 39,682,838 (GRCm39) S319P probably benign Het
Rftn1 G T 17: 50,354,408 (GRCm39) A318D probably damaging Het
Rgl3 A G 9: 21,900,159 (GRCm39) S44P probably benign Het
Rnf214 C A 9: 45,778,797 (GRCm39) probably null Het
Rpsa T C 9: 119,958,317 (GRCm39) V76A possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,130 (GRCm39) probably benign Het
Senp7 T C 16: 55,978,973 (GRCm39) V529A probably benign Het
Siglecg C T 7: 43,058,320 (GRCm39) S69L probably benign Het
Sos1 G T 17: 80,705,842 (GRCm39) T1243K probably damaging Het
Tent5a T C 9: 85,208,784 (GRCm39) D13G possibly damaging Het
Tlcd3a A G 11: 76,096,244 (GRCm39) H124R probably damaging Het
Tmc2 A G 2: 130,106,084 (GRCm39) T872A probably benign Het
Tnfrsf8 A C 4: 145,023,511 (GRCm39) C107W probably damaging Het
Tnn T C 1: 159,937,986 (GRCm39) Y913C probably damaging Het
Ttn T C 2: 76,568,376 (GRCm39) T19179A probably damaging Het
Usp42 T A 5: 143,706,137 (GRCm39) K294N probably damaging Het
Vmn1r123 T A 7: 20,896,971 (GRCm39) C288S probably benign Het
Vmn1r29 T A 6: 58,285,191 (GRCm39) *304K probably null Het
Vmn2r1 T C 3: 63,997,334 (GRCm39) I330T probably damaging Het
Vmn2r16 A G 5: 109,511,997 (GRCm39) I735V probably benign Het
Vmn2r65 T C 7: 84,595,960 (GRCm39) I241M probably benign Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20,594,383 (GRCm39) missense probably benign 0.22
IGL01723:Dsg4 APN 18 20,599,567 (GRCm39) missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20,594,361 (GRCm39) missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20,579,307 (GRCm39) splice site probably benign
IGL02553:Dsg4 APN 18 20,595,577 (GRCm39) missense probably benign
IGL02578:Dsg4 APN 18 20,604,250 (GRCm39) missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20,591,637 (GRCm39) missense probably benign 0.01
IGL02677:Dsg4 APN 18 20,597,933 (GRCm39) missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20,604,553 (GRCm39) missense probably benign
IGL02747:Dsg4 APN 18 20,579,995 (GRCm39) missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20,584,880 (GRCm39) missense probably damaging 1.00
burrito UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
woodshed UTSW 18 20,584,929 (GRCm39) nonsense probably null
R0043:Dsg4 UTSW 18 20,586,029 (GRCm39) missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20,603,936 (GRCm39) missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20,591,628 (GRCm39) missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20,594,416 (GRCm39) missense probably benign 0.00
R0622:Dsg4 UTSW 18 20,582,845 (GRCm39) missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20,587,703 (GRCm39) splice site probably benign
R0786:Dsg4 UTSW 18 20,582,429 (GRCm39) critical splice donor site probably null
R1114:Dsg4 UTSW 18 20,599,540 (GRCm39) missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20,579,929 (GRCm39) nonsense probably null
R1372:Dsg4 UTSW 18 20,582,733 (GRCm39) splice site probably null
R1382:Dsg4 UTSW 18 20,598,181 (GRCm39) missense probably benign 0.00
R1392:Dsg4 UTSW 18 20,579,304 (GRCm39) splice site probably benign
R1442:Dsg4 UTSW 18 20,595,717 (GRCm39) missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20,582,736 (GRCm39) missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20,604,646 (GRCm39) missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20,595,518 (GRCm39) nonsense probably null
R1765:Dsg4 UTSW 18 20,589,888 (GRCm39) missense probably benign 0.01
R1817:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20,604,269 (GRCm39) missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20,599,693 (GRCm39) nonsense probably null
R2097:Dsg4 UTSW 18 20,604,101 (GRCm39) missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20,594,499 (GRCm39) missense probably benign
R3551:Dsg4 UTSW 18 20,584,813 (GRCm39) missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20,604,058 (GRCm39) missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20,582,291 (GRCm39) missense probably benign
R3955:Dsg4 UTSW 18 20,582,432 (GRCm39) splice site probably null
R4006:Dsg4 UTSW 18 20,604,022 (GRCm39) missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20,584,919 (GRCm39) missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20,591,636 (GRCm39) nonsense probably null
R4254:Dsg4 UTSW 18 20,604,595 (GRCm39) missense probably benign 0.07
R4504:Dsg4 UTSW 18 20,594,493 (GRCm39) missense probably benign 0.00
R4559:Dsg4 UTSW 18 20,603,978 (GRCm39) missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20,604,302 (GRCm39) missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20,595,470 (GRCm39) missense probably benign 0.10
R4683:Dsg4 UTSW 18 20,594,466 (GRCm39) missense probably benign
R4700:Dsg4 UTSW 18 20,589,965 (GRCm39) missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20,579,888 (GRCm39) missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20,604,184 (GRCm39) missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20,599,678 (GRCm39) missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20,579,896 (GRCm39) missense probably benign 0.21
R5426:Dsg4 UTSW 18 20,591,541 (GRCm39) missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20,595,549 (GRCm39) nonsense probably null
R5982:Dsg4 UTSW 18 20,598,226 (GRCm39) missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20,599,724 (GRCm39) missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20,582,847 (GRCm39) missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20,604,420 (GRCm39) missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20,591,578 (GRCm39) missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20,584,909 (GRCm39) missense probably benign 0.01
R7196:Dsg4 UTSW 18 20,599,537 (GRCm39) missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20,579,323 (GRCm39) nonsense probably null
R7438:Dsg4 UTSW 18 20,599,685 (GRCm39) missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20,584,993 (GRCm39) splice site probably null
R7612:Dsg4 UTSW 18 20,604,047 (GRCm39) missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20,582,769 (GRCm39) missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20,587,726 (GRCm39) missense probably damaging 1.00
R8251:Dsg4 UTSW 18 20,604,221 (GRCm39) missense probably damaging 1.00
R8326:Dsg4 UTSW 18 20,582,788 (GRCm39) missense probably benign 0.31
R8911:Dsg4 UTSW 18 20,584,929 (GRCm39) nonsense probably null
R9059:Dsg4 UTSW 18 20,604,182 (GRCm39) missense possibly damaging 0.62
R9508:Dsg4 UTSW 18 20,604,070 (GRCm39) missense probably damaging 1.00
R9607:Dsg4 UTSW 18 20,586,047 (GRCm39) missense probably benign 0.00
R9765:Dsg4 UTSW 18 20,604,334 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTACTGGCTTGCTTGAGTTCCA -3'
(R):5'- TGGCTGCTCTTCCAGAAGAC -3'

Sequencing Primer
(F):5'- GCTTGCTTGAGTTCCAGATATAGTC -3'
(R):5'- TTAGTTCCTGGGAAACTGACACC -3'
Posted On 2021-01-18