Incidental Mutation 'R8556:Olfr1208'
ID 660086
Institutional Source Beutler Lab
Gene Symbol Olfr1208
Ensembl Gene ENSMUSG00000075114
Gene Name olfactory receptor 1208
Synonyms MOR225-4, GA_x6K02T2Q125-50372411-50371485
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8556 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 88895575-88902311 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 88897038 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 186 (C186*)
Ref Sequence ENSEMBL: ENSMUSP00000149695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099810] [ENSMUST00000214121] [ENSMUST00000214297]
AlphaFold Q8VG47
Predicted Effect probably null
Transcript: ENSMUST00000099810
AA Change: C186*
SMART Domains Protein: ENSMUSP00000097398
Gene: ENSMUSG00000075114
AA Change: C186*

DomainStartEndE-ValueType
Pfam:7tm_4 28 302 1.9e-48 PFAM
Pfam:7tm_1 38 284 2.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214121
AA Change: C186*
Predicted Effect probably null
Transcript: ENSMUST00000214297
AA Change: C186*
Meta Mutation Damage Score 0.9576 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl A T 11: 70,013,550 M148K probably benign Het
Adcy2 T C 13: 68,630,975 Y982C possibly damaging Het
Adgrl4 T C 3: 151,510,665 I495T probably damaging Het
Ankfn1 A T 11: 89,441,442 I426K possibly damaging Het
Birc6 T G 17: 74,557,954 S236R probably benign Het
Cdan1 C T 2: 120,722,990 V971M probably damaging Het
Col6a4 A G 9: 106,067,053 F1074S probably damaging Het
Crk A G 11: 75,692,521 K189R probably benign Het
Dennd5b A G 6: 148,993,770 L1254P probably damaging Het
Dlec1 A G 9: 119,126,221 T658A probably benign Het
Dock2 T C 11: 34,262,457 D1228G possibly damaging Het
Dync2h1 T C 9: 7,113,198 Y209C probably benign Het
Edem3 G A 1: 151,784,835 V283I possibly damaging Het
Elavl1 A G 8: 4,295,388 S202P possibly damaging Het
Eprs G A 1: 185,420,288 probably null Het
Esp31 A T 17: 38,641,051 M1L probably benign Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Helz2 A G 2: 181,229,557 V2754A probably damaging Het
Hgsnat C T 8: 25,953,280 probably null Het
Hoxb6 G T 11: 96,300,717 R155L probably damaging Het
Igkv6-17 T C 6: 70,371,762 V39A probably damaging Het
Iqgap1 G A 7: 80,726,039 L1363F probably damaging Het
Lcor TCA T 19: 41,558,424 probably null Het
Macf1 A G 4: 123,488,343 S476P probably damaging Het
Mdh1b A C 1: 63,710,982 probably null Het
Muc16 T A 9: 18,640,937 I4687L probably benign Het
Mylk3 T C 8: 85,327,273 M672V possibly damaging Het
Nbea A G 3: 55,647,386 F2614L probably benign Het
Otop3 T A 11: 115,344,956 D471E probably benign Het
Pds5b G A 5: 150,792,608 M1077I probably benign Het
Plppr5 T A 3: 117,672,030 L310Q probably benign Het
Ptpn13 G A 5: 103,559,172 E1416K probably damaging Het
Ptprj A G 2: 90,440,700 L1228P probably damaging Het
Rbm12 T C 2: 156,096,561 D597G probably damaging Het
Ret A G 6: 118,169,188 F777L probably damaging Het
Rrbp1 A T 2: 143,989,125 V374D possibly damaging Het
Scin T C 12: 40,077,594 probably null Het
Serpina1a T A 12: 103,855,970 K234N probably damaging Het
Snx20 T A 8: 88,630,033 M52L probably benign Het
Svs6 T C 2: 164,317,565 S83P possibly damaging Het
Tcrg-C4 A G 13: 19,344,782 probably benign Het
Tdp1 T C 12: 99,891,268 S29P probably benign Het
Tet1 T C 10: 62,840,206 N697S probably benign Het
Trpv3 A G 11: 73,287,465 I453V probably benign Het
Trrap T C 5: 144,825,937 F2407L probably benign Het
Tsc22d4 T C 5: 137,747,587 S158P probably damaging Het
Uaca A T 9: 60,870,641 K768M probably damaging Het
Wdr20rt G A 12: 65,226,965 V228I probably benign Het
Zbtb7b T C 3: 89,393,137 probably null Het
Other mutations in Olfr1208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01340:Olfr1208 APN 2 88896977 missense probably damaging 1.00
IGL02132:Olfr1208 APN 2 88897159 missense probably benign
IGL02374:Olfr1208 APN 2 88897459 missense probably damaging 1.00
R1378:Olfr1208 UTSW 2 88897026 missense probably benign 0.01
R1570:Olfr1208 UTSW 2 88896946 missense probably damaging 1.00
R2056:Olfr1208 UTSW 2 88896761 missense probably damaging 1.00
R2092:Olfr1208 UTSW 2 88897267 missense probably damaging 0.99
R2185:Olfr1208 UTSW 2 88896703 missense probably damaging 0.99
R5223:Olfr1208 UTSW 2 88897334 missense probably benign 0.03
R5479:Olfr1208 UTSW 2 88896691 missense probably benign 0.13
R6463:Olfr1208 UTSW 2 88897118 missense probably benign 0.00
R6859:Olfr1208 UTSW 2 88896934 missense probably benign
R7347:Olfr1208 UTSW 2 88897271 missense possibly damaging 0.51
R7352:Olfr1208 UTSW 2 88896718 missense probably damaging 1.00
R7544:Olfr1208 UTSW 2 88897361 missense probably damaging 1.00
R7713:Olfr1208 UTSW 2 88897778 start gained probably benign
R7842:Olfr1208 UTSW 2 88896961 missense possibly damaging 0.89
R7869:Olfr1208 UTSW 2 88897064 missense probably benign 0.00
R8137:Olfr1208 UTSW 2 88896669 makesense probably null
R8168:Olfr1208 UTSW 2 88896776 missense probably benign 0.09
R8967:Olfr1208 UTSW 2 88897500 nonsense probably null
R9092:Olfr1208 UTSW 2 88896977 missense probably damaging 1.00
R9221:Olfr1208 UTSW 2 88896911 missense probably benign
Z1176:Olfr1208 UTSW 2 88897061 missense probably damaging 1.00
Z1177:Olfr1208 UTSW 2 88896800 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACAACGGTGATGTGTGAGCC -3'
(R):5'- TCATCTTGGTGGTAATGGCC -3'

Sequencing Primer
(F):5'- CCACAGGTAGAAAGAGCTTTGC -3'
(R):5'- ATCGGTATGTAGCTATTTGCAGACCC -3'
Posted On 2021-01-18