Incidental Mutation 'R8556:Col6a4'
ID660114
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8556 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106067053 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1074 (F1074S)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect probably damaging
Transcript: ENSMUST00000121963
AA Change: F1074S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: F1074S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl A T 11: 70,013,550 M148K probably benign Het
Adcy2 T C 13: 68,630,975 Y982C possibly damaging Het
Adgrl4 T C 3: 151,510,665 I495T probably damaging Het
Ankfn1 A T 11: 89,441,442 I426K possibly damaging Het
Birc6 T G 17: 74,557,954 S236R probably benign Het
Cdan1 C T 2: 120,722,990 V971M probably damaging Het
Crk A G 11: 75,692,521 K189R probably benign Het
Dennd5b A G 6: 148,993,770 L1254P probably damaging Het
Dlec1 A G 9: 119,126,221 T658A probably benign Het
Dock2 T C 11: 34,262,457 D1228G possibly damaging Het
Dync2h1 T C 9: 7,113,198 Y209C probably benign Het
Edem3 G A 1: 151,784,835 V283I possibly damaging Het
Elavl1 A G 8: 4,295,388 S202P possibly damaging Het
Eprs G A 1: 185,420,288 probably null Het
Esp31 A T 17: 38,641,051 M1L probably benign Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Helz2 A G 2: 181,229,557 V2754A probably damaging Het
Hgsnat C T 8: 25,953,280 probably null Het
Hoxb6 G T 11: 96,300,717 R155L probably damaging Het
Igkv6-17 T C 6: 70,371,762 V39A probably damaging Het
Iqgap1 G A 7: 80,726,039 L1363F probably damaging Het
Lcor TCA T 19: 41,558,424 probably null Het
Macf1 A G 4: 123,488,343 S476P probably damaging Het
Mdh1b A C 1: 63,710,982 probably null Het
Muc16 T A 9: 18,640,937 I4687L probably benign Het
Mylk3 T C 8: 85,327,273 M672V possibly damaging Het
Nbea A G 3: 55,647,386 F2614L probably benign Het
Olfr1208 A T 2: 88,897,038 C186* probably null Het
Otop3 T A 11: 115,344,956 D471E probably benign Het
Pds5b G A 5: 150,792,608 M1077I probably benign Het
Plppr5 T A 3: 117,672,030 L310Q probably benign Het
Ptpn13 G A 5: 103,559,172 E1416K probably damaging Het
Ptprj A G 2: 90,440,700 L1228P probably damaging Het
Rbm12 T C 2: 156,096,561 D597G probably damaging Het
Ret A G 6: 118,169,188 F777L probably damaging Het
Rrbp1 A T 2: 143,989,125 V374D possibly damaging Het
Scin T C 12: 40,077,594 probably null Het
Serpina1a T A 12: 103,855,970 K234N probably damaging Het
Snx20 T A 8: 88,630,033 M52L probably benign Het
Svs6 T C 2: 164,317,565 S83P possibly damaging Het
Tcrg-C4 A G 13: 19,344,782 probably benign Het
Tdp1 T C 12: 99,891,268 S29P probably benign Het
Tet1 T C 10: 62,840,206 N697S probably benign Het
Trpv3 A G 11: 73,287,465 I453V probably benign Het
Trrap T C 5: 144,825,937 F2407L probably benign Het
Tsc22d4 T C 5: 137,747,587 S158P probably damaging Het
Uaca A T 9: 60,870,641 K768M probably damaging Het
Wdr20rt G A 12: 65,226,965 V228I probably benign Het
Zbtb7b T C 3: 89,393,137 probably null Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0092:Col6a4 UTSW 9 106013314 missense probably benign 0.04
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
R7015:Col6a4 UTSW 9 106033755 critical splice donor site probably null
R7027:Col6a4 UTSW 9 106067014 missense probably damaging 1.00
R7088:Col6a4 UTSW 9 106000686 missense possibly damaging 0.56
R7200:Col6a4 UTSW 9 106072249 missense possibly damaging 0.68
R7238:Col6a4 UTSW 9 106000320 missense probably damaging 0.99
R7273:Col6a4 UTSW 9 106000457 missense possibly damaging 0.92
R7335:Col6a4 UTSW 9 106076892 missense possibly damaging 0.90
R7418:Col6a4 UTSW 9 106022915 missense probably damaging 1.00
R7421:Col6a4 UTSW 9 106020795 missense probably damaging 0.99
R7530:Col6a4 UTSW 9 106068390 missense probably damaging 0.99
R7600:Col6a4 UTSW 9 106066999 missense possibly damaging 0.86
R7701:Col6a4 UTSW 9 106082888 missense probably benign 0.17
R7830:Col6a4 UTSW 9 106075390 missense probably damaging 0.99
R7881:Col6a4 UTSW 9 106080298 missense probably benign 0.14
R8157:Col6a4 UTSW 9 106067898 missense possibly damaging 0.92
R8292:Col6a4 UTSW 9 106076877 missense probably benign 0.01
R8309:Col6a4 UTSW 9 106075215 missense probably benign 0.08
R8336:Col6a4 UTSW 9 106075329 missense possibly damaging 0.65
R8359:Col6a4 UTSW 9 106068384 missense probably benign 0.00
R8530:Col6a4 UTSW 9 106080505 missense probably benign 0.31
RF022:Col6a4 UTSW 9 106077008 missense probably damaging 0.99
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Z1176:Col6a4 UTSW 9 106000797 missense probably benign
Z1176:Col6a4 UTSW 9 106000870 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGTGATCACAATCAAATACTGATG -3'
(R):5'- ACTGGTTCCAGGTTCTGACC -3'

Sequencing Primer
(F):5'- CAAATACTGATGAACTCTGGGTCTCC -3'
(R):5'- GACCAAATGTCCTCTCGTGTTG -3'
Posted On2021-01-18