Incidental Mutation 'R8556:Trpv3'
ID660120
Institutional Source Beutler Lab
Gene Symbol Trpv3
Ensembl Gene ENSMUSG00000043029
Gene Nametransient receptor potential cation channel, subfamily V, member 3
SynonymsNh, VRL3, 1110036I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R8556 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location73267388-73300363 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73287465 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 453 (I453V)
Ref Sequence ENSEMBL: ENSMUSP00000053755 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049676]
PDB Structure Crystal structure of the N-terminal ankyrin repeat domain of TRPV3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000049676
AA Change: I453V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000053755
Gene: ENSMUSG00000043029
AA Change: I453V

DomainStartEndE-ValueType
low complexity region 81 92 N/A INTRINSIC
low complexity region 109 122 N/A INTRINSIC
low complexity region 133 153 N/A INTRINSIC
ANK 167 201 1.21e2 SMART
ANK 214 243 3.54e-1 SMART
ANK 261 291 1.36e-2 SMART
ANK 340 370 6.71e-2 SMART
low complexity region 417 431 N/A INTRINSIC
Pfam:Ion_trans 437 689 3.9e-9 PFAM
Meta Mutation Damage Score 0.0772 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of nonselective cation channels that function in a variety of processes, including temperature sensation and vasoregulation. The thermosensitive members of this family are expressed in subsets of sensory neurons that terminate in the skin, and are activated at distinct physiological temperatures. This channel is activated at temperatures between 22 and 40 degrees C. This gene lies in close proximity to another family member gene on chromosome 17, and the two encoded proteins are thought to associate with each other to form heteromeric channels. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous null mice have strong deficits in response to innocuous and noxious heat but not in other sensory modalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl A T 11: 70,013,550 M148K probably benign Het
Adcy2 T C 13: 68,630,975 Y982C possibly damaging Het
Adgrl4 T C 3: 151,510,665 I495T probably damaging Het
Ankfn1 A T 11: 89,441,442 I426K possibly damaging Het
Birc6 T G 17: 74,557,954 S236R probably benign Het
Cdan1 C T 2: 120,722,990 V971M probably damaging Het
Col6a4 A G 9: 106,067,053 F1074S probably damaging Het
Crk A G 11: 75,692,521 K189R probably benign Het
Dennd5b A G 6: 148,993,770 L1254P probably damaging Het
Dlec1 A G 9: 119,126,221 T658A probably benign Het
Dock2 T C 11: 34,262,457 D1228G possibly damaging Het
Dync2h1 T C 9: 7,113,198 Y209C probably benign Het
Edem3 G A 1: 151,784,835 V283I possibly damaging Het
Elavl1 A G 8: 4,295,388 S202P possibly damaging Het
Eprs G A 1: 185,420,288 probably null Het
Esp31 A T 17: 38,641,051 M1L probably benign Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Helz2 A G 2: 181,229,557 V2754A probably damaging Het
Hgsnat C T 8: 25,953,280 probably null Het
Hoxb6 G T 11: 96,300,717 R155L probably damaging Het
Igkv6-17 T C 6: 70,371,762 V39A probably damaging Het
Iqgap1 G A 7: 80,726,039 L1363F probably damaging Het
Lcor TCA T 19: 41,558,424 probably null Het
Macf1 A G 4: 123,488,343 S476P probably damaging Het
Mdh1b A C 1: 63,710,982 probably null Het
Muc16 T A 9: 18,640,937 I4687L probably benign Het
Mylk3 T C 8: 85,327,273 M672V possibly damaging Het
Nbea A G 3: 55,647,386 F2614L probably benign Het
Olfr1208 A T 2: 88,897,038 C186* probably null Het
Otop3 T A 11: 115,344,956 D471E probably benign Het
Pds5b G A 5: 150,792,608 M1077I probably benign Het
Plppr5 T A 3: 117,672,030 L310Q probably benign Het
Ptpn13 G A 5: 103,559,172 E1416K probably damaging Het
Ptprj A G 2: 90,440,700 L1228P probably damaging Het
Rbm12 T C 2: 156,096,561 D597G probably damaging Het
Ret A G 6: 118,169,188 F777L probably damaging Het
Rrbp1 A T 2: 143,989,125 V374D possibly damaging Het
Scin T C 12: 40,077,594 probably null Het
Serpina1a T A 12: 103,855,970 K234N probably damaging Het
Snx20 T A 8: 88,630,033 M52L probably benign Het
Svs6 T C 2: 164,317,565 S83P possibly damaging Het
Tcrg-C4 A G 13: 19,344,782 probably benign Het
Tdp1 T C 12: 99,891,268 S29P probably benign Het
Tet1 T C 10: 62,840,206 N697S probably benign Het
Trrap T C 5: 144,825,937 F2407L probably benign Het
Tsc22d4 T C 5: 137,747,587 S158P probably damaging Het
Uaca A T 9: 60,870,641 K768M probably damaging Het
Wdr20rt G A 12: 65,226,965 V228I probably benign Het
Zbtb7b T C 3: 89,393,137 probably null Het
Other mutations in Trpv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Trpv3 APN 11 73294000 critical splice donor site probably null
IGL01161:Trpv3 APN 11 73296718 splice site probably benign
IGL02130:Trpv3 APN 11 73279770 missense probably benign 0.00
IGL02957:Trpv3 APN 11 73285872 missense probably damaging 1.00
IGL03334:Trpv3 APN 11 73281665 splice site probably benign
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0103:Trpv3 UTSW 11 73293979 missense probably damaging 1.00
R0546:Trpv3 UTSW 11 73297187 missense probably damaging 1.00
R0685:Trpv3 UTSW 11 73296814 splice site probably benign
R0969:Trpv3 UTSW 11 73278938 nonsense probably null
R1748:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R1974:Trpv3 UTSW 11 73283688 missense probably damaging 0.99
R2015:Trpv3 UTSW 11 73279827 missense probably damaging 0.97
R3426:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3427:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3428:Trpv3 UTSW 11 73285941 missense probably damaging 1.00
R3618:Trpv3 UTSW 11 73295455 missense probably damaging 1.00
R3712:Trpv3 UTSW 11 73278954 missense probably benign
R3916:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3917:Trpv3 UTSW 11 73283734 missense possibly damaging 0.87
R3961:Trpv3 UTSW 11 73287420 nonsense probably null
R4242:Trpv3 UTSW 11 73277823 missense probably benign 0.43
R4277:Trpv3 UTSW 11 73296438 missense probably damaging 0.97
R4506:Trpv3 UTSW 11 73295324 missense probably benign 0.40
R4629:Trpv3 UTSW 11 73281789 missense probably damaging 0.99
R4656:Trpv3 UTSW 11 73295414 missense probably damaging 1.00
R5059:Trpv3 UTSW 11 73295323 missense probably benign 0.00
R5121:Trpv3 UTSW 11 73277834 critical splice donor site probably null
R6113:Trpv3 UTSW 11 73286018 missense probably benign 0.10
R6130:Trpv3 UTSW 11 73296483 missense possibly damaging 0.49
R6342:Trpv3 UTSW 11 73283863 missense probably damaging 1.00
R6850:Trpv3 UTSW 11 73291693 missense probably damaging 1.00
R7180:Trpv3 UTSW 11 73277992 missense probably benign
R7434:Trpv3 UTSW 11 73288261 missense probably damaging 0.96
R7440:Trpv3 UTSW 11 73277974 missense probably benign 0.37
R7741:Trpv3 UTSW 11 73288262 missense probably damaging 0.99
R7750:Trpv3 UTSW 11 73286021 missense probably damaging 0.99
R7785:Trpv3 UTSW 11 73277732 missense probably benign 0.43
R8309:Trpv3 UTSW 11 73279921 missense probably damaging 1.00
R8354:Trpv3 UTSW 11 73291622 missense probably damaging 1.00
R8383:Trpv3 UTSW 11 73289301 missense probably benign 0.30
R8443:Trpv3 UTSW 11 73295383 missense possibly damaging 0.84
R8454:Trpv3 UTSW 11 73291622 missense probably damaging 1.00
R8492:Trpv3 UTSW 11 73288209 nonsense probably null
R8701:Trpv3 UTSW 11 73278936 missense possibly damaging 0.84
R9046:Trpv3 UTSW 11 73285872 missense probably damaging 1.00
Z1186:Trpv3 UTSW 11 73269687 missense probably benign
Z1186:Trpv3 UTSW 11 73278977 missense probably benign
Z1186:Trpv3 UTSW 11 73283676 missense probably benign
Z1187:Trpv3 UTSW 11 73269687 missense probably benign
Z1187:Trpv3 UTSW 11 73278977 missense probably benign
Z1187:Trpv3 UTSW 11 73283676 missense probably benign
Z1188:Trpv3 UTSW 11 73269687 missense probably benign
Z1188:Trpv3 UTSW 11 73278977 missense probably benign
Z1188:Trpv3 UTSW 11 73283676 missense probably benign
Z1189:Trpv3 UTSW 11 73269687 missense probably benign
Z1189:Trpv3 UTSW 11 73278977 missense probably benign
Z1189:Trpv3 UTSW 11 73283676 missense probably benign
Z1190:Trpv3 UTSW 11 73269687 missense probably benign
Z1190:Trpv3 UTSW 11 73278977 missense probably benign
Z1190:Trpv3 UTSW 11 73283676 missense probably benign
Z1191:Trpv3 UTSW 11 73269687 missense probably benign
Z1191:Trpv3 UTSW 11 73278977 missense probably benign
Z1191:Trpv3 UTSW 11 73283676 missense probably benign
Z1192:Trpv3 UTSW 11 73269687 missense probably benign
Z1192:Trpv3 UTSW 11 73278977 missense probably benign
Z1192:Trpv3 UTSW 11 73283676 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATGAAAAGAGTCTACAGCTTTGG -3'
(R):5'- GTATGTCTAACCATTCTATTCGCCAG -3'

Sequencing Primer
(F):5'- AGAACCGACATGAGATGC -3'
(R):5'- ATTCTATTCGCCAGGAACTTTGG -3'
Posted On2021-01-18