Incidental Mutation 'R8556:Tcrg-C4'
ID660129
Institutional Source Beutler Lab
Gene Symbol Tcrg-C4
Ensembl Gene ENSMUSG00000076757
Gene NameT cell receptor gamma, constant 4
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8556 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location19344558-19352343 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 19344782 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103564] [ENSMUST00000184430]
Predicted Effect probably benign
Transcript: ENSMUST00000103564
SMART Domains Protein: ENSMUSP00000100342
Gene: ENSMUSG00000076755

DomainStartEndE-ValueType
IGv 34 113 8.44e-11 SMART
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000184430
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl A T 11: 70,013,550 M148K probably benign Het
Adcy2 T C 13: 68,630,975 Y982C possibly damaging Het
Adgrl4 T C 3: 151,510,665 I495T probably damaging Het
Ankfn1 A T 11: 89,441,442 I426K possibly damaging Het
Birc6 T G 17: 74,557,954 S236R probably benign Het
Cdan1 C T 2: 120,722,990 V971M probably damaging Het
Col6a4 A G 9: 106,067,053 F1074S probably damaging Het
Crk A G 11: 75,692,521 K189R probably benign Het
Dennd5b A G 6: 148,993,770 L1254P probably damaging Het
Dlec1 A G 9: 119,126,221 T658A probably benign Het
Dock2 T C 11: 34,262,457 D1228G possibly damaging Het
Dync2h1 T C 9: 7,113,198 Y209C probably benign Het
Edem3 G A 1: 151,784,835 V283I possibly damaging Het
Elavl1 A G 8: 4,295,388 S202P possibly damaging Het
Eprs G A 1: 185,420,288 probably null Het
Esp31 A T 17: 38,641,051 M1L probably benign Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Helz2 A G 2: 181,229,557 V2754A probably damaging Het
Hgsnat C T 8: 25,953,280 probably null Het
Hoxb6 G T 11: 96,300,717 R155L probably damaging Het
Igkv6-17 T C 6: 70,371,762 V39A probably damaging Het
Iqgap1 G A 7: 80,726,039 L1363F probably damaging Het
Lcor TCA T 19: 41,558,424 probably null Het
Macf1 A G 4: 123,488,343 S476P probably damaging Het
Mdh1b A C 1: 63,710,982 probably null Het
Muc16 T A 9: 18,640,937 I4687L probably benign Het
Mylk3 T C 8: 85,327,273 M672V possibly damaging Het
Nbea A G 3: 55,647,386 F2614L probably benign Het
Olfr1208 A T 2: 88,897,038 C186* probably null Het
Otop3 T A 11: 115,344,956 D471E probably benign Het
Pds5b G A 5: 150,792,608 M1077I probably benign Het
Plppr5 T A 3: 117,672,030 L310Q probably benign Het
Ptpn13 G A 5: 103,559,172 E1416K probably damaging Het
Ptprj A G 2: 90,440,700 L1228P probably damaging Het
Rbm12 T C 2: 156,096,561 D597G probably damaging Het
Ret A G 6: 118,169,188 F777L probably damaging Het
Rrbp1 A T 2: 143,989,125 V374D possibly damaging Het
Scin T C 12: 40,077,594 probably null Het
Serpina1a T A 12: 103,855,970 K234N probably damaging Het
Snx20 T A 8: 88,630,033 M52L probably benign Het
Svs6 T C 2: 164,317,565 S83P possibly damaging Het
Tdp1 T C 12: 99,891,268 S29P probably benign Het
Tet1 T C 10: 62,840,206 N697S probably benign Het
Trpv3 A G 11: 73,287,465 I453V probably benign Het
Trrap T C 5: 144,825,937 F2407L probably benign Het
Tsc22d4 T C 5: 137,747,587 S158P probably damaging Het
Uaca A T 9: 60,870,641 K768M probably damaging Het
Wdr20rt G A 12: 65,226,965 V228I probably benign Het
Zbtb7b T C 3: 89,393,137 probably null Het
Other mutations in Tcrg-C4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03328:Tcrg-C4 APN 13 19352246 missense unknown
R4633:Tcrg-C4 UTSW 13 19352287 missense probably benign 0.00
R5035:Tcrg-C4 UTSW 13 19352336 missense unknown
R5125:Tcrg-C4 UTSW 13 19344762 unclassified probably benign
R5178:Tcrg-C4 UTSW 13 19344762 unclassified probably benign
R5556:Tcrg-C4 UTSW 13 19352307 missense unknown
R7006:Tcrg-C4 UTSW 13 19344825 unclassified probably benign
R7952:Tcrg-C4 UTSW 13 19349570 missense
Predicted Primers PCR Primer
(F):5'- TCCTTCTGCTGCTGAAACAAATC -3'
(R):5'- AACATTCTCGGGGACAGAAG -3'

Sequencing Primer
(F):5'- TCTCCATAAGGCTGGGACCTAC -3'
(R):5'- TTCTCGGGGACAGAAGAATATGGTTC -3'
Posted On2021-01-18