Incidental Mutation 'R8556:Lcor'
ID 660133
Institutional Source Beutler Lab
Gene Symbol Lcor
Ensembl Gene ENSMUSG00000025019
Gene Name ligand dependent nuclear receptor corepressor
Synonyms A630025C20Rik, Mlr2, 3110023F06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock # R8556 (G1)
Quality Score 217.468
Status Validated
Chromosome 19
Chromosomal Location 41482645-41562246 bp(+) (GRCm38)
Type of Mutation frame shift
DNA Base Change (assembly) TCA to T at 41558424 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067795] [ENSMUST00000163929]
AlphaFold Q6ZPI3
Predicted Effect probably null
Transcript: ENSMUST00000067795
SMART Domains Protein: ENSMUSP00000067603
Gene: ENSMUSG00000025019

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:HTH_psq 350 395 1.2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163929
SMART Domains Protein: ENSMUSP00000126441
Gene: ENSMUSG00000025019

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
Pfam:HTH_psq 350 395 5.1e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] LCOR is a transcriptional corepressor widely expressed in fetal and adult tissues that is recruited to agonist-bound nuclear receptors through a single LxxLL motif, also referred to as a nuclear receptor (NR) box (Fernandes et al., 2003 [PubMed 12535528]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadvl A T 11: 70,013,550 M148K probably benign Het
Adcy2 T C 13: 68,630,975 Y982C possibly damaging Het
Adgrl4 T C 3: 151,510,665 I495T probably damaging Het
Ankfn1 A T 11: 89,441,442 I426K possibly damaging Het
Birc6 T G 17: 74,557,954 S236R probably benign Het
Cdan1 C T 2: 120,722,990 V971M probably damaging Het
Col6a4 A G 9: 106,067,053 F1074S probably damaging Het
Crk A G 11: 75,692,521 K189R probably benign Het
Dennd5b A G 6: 148,993,770 L1254P probably damaging Het
Dlec1 A G 9: 119,126,221 T658A probably benign Het
Dock2 T C 11: 34,262,457 D1228G possibly damaging Het
Dync2h1 T C 9: 7,113,198 Y209C probably benign Het
Edem3 G A 1: 151,784,835 V283I possibly damaging Het
Elavl1 A G 8: 4,295,388 S202P possibly damaging Het
Eprs G A 1: 185,420,288 probably null Het
Esp31 A T 17: 38,641,051 M1L probably benign Het
Eya4 G A 10: 23,106,258 H601Y probably damaging Het
Gm6370 T C 5: 146,493,892 S296P probably benign Het
Helz2 A G 2: 181,229,557 V2754A probably damaging Het
Hgsnat C T 8: 25,953,280 probably null Het
Hoxb6 G T 11: 96,300,717 R155L probably damaging Het
Igkv6-17 T C 6: 70,371,762 V39A probably damaging Het
Iqgap1 G A 7: 80,726,039 L1363F probably damaging Het
Macf1 A G 4: 123,488,343 S476P probably damaging Het
Mdh1b A C 1: 63,710,982 probably null Het
Muc16 T A 9: 18,640,937 I4687L probably benign Het
Mylk3 T C 8: 85,327,273 M672V possibly damaging Het
Nbea A G 3: 55,647,386 F2614L probably benign Het
Olfr1208 A T 2: 88,897,038 C186* probably null Het
Otop3 T A 11: 115,344,956 D471E probably benign Het
Pds5b G A 5: 150,792,608 M1077I probably benign Het
Plppr5 T A 3: 117,672,030 L310Q probably benign Het
Ptpn13 G A 5: 103,559,172 E1416K probably damaging Het
Ptprj A G 2: 90,440,700 L1228P probably damaging Het
Rbm12 T C 2: 156,096,561 D597G probably damaging Het
Ret A G 6: 118,169,188 F777L probably damaging Het
Rrbp1 A T 2: 143,989,125 V374D possibly damaging Het
Scin T C 12: 40,077,594 probably null Het
Serpina1a T A 12: 103,855,970 K234N probably damaging Het
Snx20 T A 8: 88,630,033 M52L probably benign Het
Svs6 T C 2: 164,317,565 S83P possibly damaging Het
Tcrg-C4 A G 13: 19,344,782 probably benign Het
Tdp1 T C 12: 99,891,268 S29P probably benign Het
Tet1 T C 10: 62,840,206 N697S probably benign Het
Trpv3 A G 11: 73,287,465 I453V probably benign Het
Trrap T C 5: 144,825,937 F2407L probably benign Het
Tsc22d4 T C 5: 137,747,587 S158P probably damaging Het
Uaca A T 9: 60,870,641 K768M probably damaging Het
Wdr20rt G A 12: 65,226,965 V228I probably benign Het
Zbtb7b T C 3: 89,393,137 probably null Het
Other mutations in Lcor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Lcor APN 19 41552700 missense probably damaging 0.97
IGL02079:Lcor APN 19 41555687 missense probably benign 0.40
IGL02100:Lcor APN 19 41558754 missense possibly damaging 0.93
IGL02444:Lcor APN 19 41559011 missense probably damaging 0.99
IGL02578:Lcor APN 19 41559150 missense probably damaging 1.00
IGL03072:Lcor APN 19 41558814 missense possibly damaging 0.85
IGL03118:Lcor APN 19 41558369 missense probably damaging 0.99
IGL03153:Lcor APN 19 41558356 missense probably damaging 0.98
R1756:Lcor UTSW 19 41559266 missense probably benign
R1889:Lcor UTSW 19 41559128 missense probably damaging 0.99
R1913:Lcor UTSW 19 41558474 missense probably benign 0.40
R1983:Lcor UTSW 19 41558367 missense probably damaging 0.98
R3885:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3886:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3888:Lcor UTSW 19 41558356 missense probably damaging 0.98
R3889:Lcor UTSW 19 41558356 missense probably damaging 0.98
R5160:Lcor UTSW 19 41555614 missense probably damaging 0.99
R6112:Lcor UTSW 19 41559081 missense possibly damaging 0.92
R7777:Lcor UTSW 19 41558795 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ATGTTACCCAAGCAAGGCC -3'
(R):5'- CCTGAACTTCATTCGGCTGAGG -3'

Sequencing Primer
(F):5'- TCTAATAAAGGAGTGGTCCCCTC -3'
(R):5'- GCTGAGGCTGAATTCATAGTGAG -3'
Posted On 2021-01-18