Incidental Mutation 'R8557:Atg16l2'
ID660160
Institutional Source Beutler Lab
Gene Symbol Atg16l2
Ensembl Gene ENSMUSG00000047767
Gene Nameautophagy related 16-like 2 (S. cerevisiae)
Synonyms2410118P20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8557 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location101263034-101302251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101290656 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 499 (H499Q)
Ref Sequence ENSEMBL: ENSMUSP00000113320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120267] [ENSMUST00000122116] [ENSMUST00000139609] [ENSMUST00000143630] [ENSMUST00000207740]
Predicted Effect probably benign
Transcript: ENSMUST00000120267
AA Change: H520Q

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112500
Gene: ENSMUSG00000047767
AA Change: H520Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 20 211 2.3e-36 PFAM
WD40 329 368 1.13e-7 SMART
WD40 373 412 6.79e-2 SMART
WD40 415 454 1.08e-4 SMART
WD40 457 493 2.97e0 SMART
WD40 496 534 1.61e-3 SMART
WD40 539 580 1.66e0 SMART
WD40 583 623 2.8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122116
AA Change: H499Q

PolyPhen 2 Score 0.427 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113320
Gene: ENSMUSG00000047767
AA Change: H499Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 5.4e-14 PFAM
WD40 308 347 1.13e-7 SMART
WD40 352 391 6.79e-2 SMART
WD40 394 433 1.08e-4 SMART
WD40 436 472 2.97e0 SMART
WD40 475 513 1.61e-3 SMART
WD40 518 559 1.66e0 SMART
WD40 562 602 2.8e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139609
SMART Domains Protein: ENSMUSP00000117387
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000143630
SMART Domains Protein: ENSMUSP00000117029
Gene: ENSMUSG00000047767

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:ATG16 17 212 1.8e-13 PFAM
WD40 329 368 1.13e-7 SMART
Blast:WD40 373 395 6e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000207740
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit lymphopenia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,611 V230A probably benign Het
Ablim2 A T 5: 35,828,139 H260L probably damaging Het
Acp4 C T 7: 44,255,848 probably null Het
Acvr2b G T 9: 119,432,588 V416L probably damaging Het
Adipoq A T 16: 23,146,680 probably benign Het
Amhr2 A G 15: 102,454,412 Q538R probably benign Het
Apoh C T 11: 108,409,236 T237I probably damaging Het
Aspm C T 1: 139,456,756 T97I probably benign Het
Bicdl2 G A 17: 23,667,562 R375H probably benign Het
C3 T C 17: 57,224,383 T304A probably benign Het
Cast A T 13: 74,704,182 D647E probably damaging Het
Chrm2 T C 6: 36,524,075 V289A probably benign Het
Clock T C 5: 76,229,370 D694G probably damaging Het
Cyp4a31 C T 4: 115,570,241 R215C possibly damaging Het
Dctn2 T C 10: 127,278,193 L334P probably damaging Het
Dnah11 A G 12: 117,878,512 I4444T probably benign Het
Egf C A 3: 129,754,951 R5L unknown Het
Ercc1 A G 7: 19,348,555 N11S probably benign Het
Eri3 T C 4: 117,615,323 S113P possibly damaging Het
Fam159a T A 4: 108,367,888 N159I probably benign Het
Fasn A G 11: 120,815,784 V958A probably benign Het
Fgf10 A G 13: 118,781,596 K140R probably benign Het
Gfra2 G A 14: 70,977,297 M163I probably benign Het
Gm14403 T C 2: 177,509,561 I191T probably damaging Het
Hdlbp T A 1: 93,413,497 E977D probably damaging Het
Hectd4 A G 5: 121,310,651 N354S possibly damaging Het
Hpgds A T 6: 65,120,015 I170N probably benign Het
Limk2 A G 11: 3,346,379 V356A possibly damaging Het
Map4 A G 9: 110,064,302 probably null Het
Mettl13 C T 1: 162,544,352 G316D possibly damaging Het
Mia2 T A 12: 59,101,488 L45I probably damaging Het
Mier1 T A 4: 103,139,346 probably null Het
Mob3a G T 10: 80,691,174 R106S probably benign Het
Mug2 T A 6: 122,063,701 F737I probably damaging Het
Myo7a C T 7: 98,053,874 A2053T probably benign Het
Myrip A G 9: 120,417,186 S127G probably benign Het
Naaladl2 T A 3: 24,208,364 K395I probably benign Het
Nedd4l A T 18: 65,203,915 M678L probably benign Het
Nefh A T 11: 4,941,233 I462N probably damaging Het
Nfe2 A G 15: 103,248,598 M322T probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr30 T A 11: 58,455,736 D71V probably damaging Het
Olfr657 T A 7: 104,635,896 V74E possibly damaging Het
Pkdcc A G 17: 83,221,066 N288S probably benign Het
Sacs G A 14: 61,207,276 C2257Y probably damaging Het
Sec23a G T 12: 59,005,270 Q90K probably damaging Het
Slc30a6 A G 17: 74,405,690 T61A possibly damaging Het
Slc39a11 C A 11: 113,250,559 A234S probably damaging Het
Smg6 C A 11: 75,156,238 N1252K probably damaging Het
Spata2 A T 2: 167,484,307 D197E probably damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Spocd1 T C 4: 129,948,968 F59L probably damaging Het
Tectb T A 19: 55,192,673 probably benign Het
Tnnc1 G A 14: 31,210,605 V82I probably damaging Het
Traf7 A T 17: 24,510,041 V513D probably damaging Het
Vmn2r111 A T 17: 22,571,929 Y129* probably null Het
Vrtn T A 12: 84,649,916 F480Y probably benign Het
Vwa8 A T 14: 79,009,209 I664F probably damaging Het
Vwde A T 6: 13,193,137 V401E probably damaging Het
Zcchc11 T A 4: 108,542,711 probably null Het
Zfp655 A T 5: 145,244,025 N231I probably benign Het
Other mutations in Atg16l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Atg16l2 APN 7 101300160 missense probably damaging 1.00
IGL00402:Atg16l2 APN 7 101296153 missense probably benign 0.00
IGL00662:Atg16l2 APN 7 101289896 missense probably benign 0.00
IGL00905:Atg16l2 APN 7 101300166 missense probably damaging 1.00
IGL01644:Atg16l2 APN 7 101297217 makesense probably null
IGL02839:Atg16l2 APN 7 101293397 missense probably damaging 1.00
R0316:Atg16l2 UTSW 7 101293396 missense probably damaging 1.00
R0638:Atg16l2 UTSW 7 101300110 critical splice donor site probably null
R0683:Atg16l2 UTSW 7 101290384 missense probably damaging 1.00
R1436:Atg16l2 UTSW 7 101291550 missense probably damaging 1.00
R1592:Atg16l2 UTSW 7 101291986 missense probably damaging 1.00
R1623:Atg16l2 UTSW 7 101289906 missense probably benign 0.01
R2002:Atg16l2 UTSW 7 101294920 missense possibly damaging 0.62
R2090:Atg16l2 UTSW 7 101293368 splice site probably null
R2103:Atg16l2 UTSW 7 101290361 critical splice donor site probably null
R2349:Atg16l2 UTSW 7 101296539 missense probably damaging 0.96
R4738:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R4739:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R4740:Atg16l2 UTSW 7 101297178 missense probably damaging 1.00
R5704:Atg16l2 UTSW 7 101300211 missense probably damaging 1.00
R6243:Atg16l2 UTSW 7 101292329 makesense probably null
R6257:Atg16l2 UTSW 7 101301895 splice site probably null
R6613:Atg16l2 UTSW 7 101290581 critical splice donor site probably null
R7331:Atg16l2 UTSW 7 101299048 missense probably damaging 1.00
R7349:Atg16l2 UTSW 7 101290266 missense probably damaging 1.00
R7719:Atg16l2 UTSW 7 101289867 missense probably damaging 1.00
R8186:Atg16l2 UTSW 7 101296507 critical splice donor site probably null
R8500:Atg16l2 UTSW 7 101290266 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGAAGCTGCAACCAGTG -3'
(R):5'- CCTGGGTTTCTCGAGACTATG -3'

Sequencing Primer
(F):5'- CAGTCTTCCTCCAGATGTGAAAAGG -3'
(R):5'- CTCGAGACTATGTTACCTGGGAATG -3'
Posted On2021-01-18