Incidental Mutation 'R8557:Acvr2b'
ID660164
Institutional Source Beutler Lab
Gene Symbol Acvr2b
Ensembl Gene ENSMUSG00000061393
Gene Nameactivin receptor IIB
SynonymsActRIIB
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8557 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119402118-119434995 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119432588 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 416 (V416L)
Ref Sequence ENSEMBL: ENSMUSP00000126108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035093] [ENSMUST00000165044] [ENSMUST00000215746]
Predicted Effect probably benign
Transcript: ENSMUST00000035093
AA Change: V408L

PolyPhen 2 Score 0.368 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000035093
Gene: ENSMUSG00000061393
AA Change: V408L

DomainStartEndE-ValueType
Pfam:Activin_recp 27 117 5.4e-13 PFAM
transmembrane domain 130 152 N/A INTRINSIC
Pfam:Pkinase 206 494 1.5e-55 PFAM
Pfam:Pkinase_Tyr 206 494 2.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165044
AA Change: V416L

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126108
Gene: ENSMUSG00000061393
AA Change: V416L

DomainStartEndE-ValueType
Pfam:Activin_recp 27 117 5.3e-14 PFAM
transmembrane domain 138 160 N/A INTRINSIC
Pfam:Pkinase_Tyr 214 502 1.7e-26 PFAM
Pfam:Pkinase 217 501 1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215746
AA Change: V392L

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Activins are dimeric growth and differentiation factors which belong to the transforming growth factor-beta (TGF-beta) superfamily of structurally related signaling proteins. Activins signal through a heteromeric complex of receptor serine kinases which include at least two type I (I and IB) and two type II (II and IIB) receptors. These receptors are all transmembrane proteins, composed of a ligand-binding extracellular domain with cysteine-rich region, a transmembrane domain, and a cytoplasmic domain with predicted serine/threonine specificity. Type I receptors are essential for signaling; and type II receptors are required for binding ligands and for expression of type I receptors. Type I and II receptors form a stable complex after ligand binding, resulting in phosphorylation of type I receptors by type II receptors. Type II receptors are considered to be constitutively active kinases. This gene encodes activin A type IIB receptor, which displays a 3- to 4-fold higher affinity for the ligand than activin A type II receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene show abnormal lateral asymmetry and homeotic transformation of the axial skeleton, and die shortly after birth with extensive cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,611 V230A probably benign Het
Ablim2 A T 5: 35,828,139 H260L probably damaging Het
Acp4 C T 7: 44,255,848 probably null Het
Adipoq A T 16: 23,146,680 probably benign Het
Amhr2 A G 15: 102,454,412 Q538R probably benign Het
Apoh C T 11: 108,409,236 T237I probably damaging Het
Aspm C T 1: 139,456,756 T97I probably benign Het
Atg16l2 A T 7: 101,290,656 H499Q probably benign Het
Bicdl2 G A 17: 23,667,562 R375H probably benign Het
C3 T C 17: 57,224,383 T304A probably benign Het
Cast A T 13: 74,704,182 D647E probably damaging Het
Chrm2 T C 6: 36,524,075 V289A probably benign Het
Clock T C 5: 76,229,370 D694G probably damaging Het
Cyp4a31 C T 4: 115,570,241 R215C possibly damaging Het
Dctn2 T C 10: 127,278,193 L334P probably damaging Het
Dnah11 A G 12: 117,878,512 I4444T probably benign Het
Egf C A 3: 129,754,951 R5L unknown Het
Ercc1 A G 7: 19,348,555 N11S probably benign Het
Eri3 T C 4: 117,615,323 S113P possibly damaging Het
Fam159a T A 4: 108,367,888 N159I probably benign Het
Fasn A G 11: 120,815,784 V958A probably benign Het
Fgf10 A G 13: 118,781,596 K140R probably benign Het
Gfra2 G A 14: 70,977,297 M163I probably benign Het
Gm14403 T C 2: 177,509,561 I191T probably damaging Het
Hdlbp T A 1: 93,413,497 E977D probably damaging Het
Hectd4 A G 5: 121,310,651 N354S possibly damaging Het
Hpgds A T 6: 65,120,015 I170N probably benign Het
Limk2 A G 11: 3,346,379 V356A possibly damaging Het
Mettl13 C T 1: 162,544,352 G316D possibly damaging Het
Mia2 T A 12: 59,101,488 L45I probably damaging Het
Mob3a G T 10: 80,691,174 R106S probably benign Het
Mug2 T A 6: 122,063,701 F737I probably damaging Het
Myo7a C T 7: 98,053,874 A2053T probably benign Het
Myrip A G 9: 120,417,186 S127G probably benign Het
Naaladl2 T A 3: 24,208,364 K395I probably benign Het
Nedd4l A T 18: 65,203,915 M678L probably benign Het
Nefh A T 11: 4,941,233 I462N probably damaging Het
Nfe2 A G 15: 103,248,598 M322T probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr30 T A 11: 58,455,736 D71V probably damaging Het
Olfr657 T A 7: 104,635,896 V74E possibly damaging Het
Pkdcc A G 17: 83,221,066 N288S probably benign Het
Sacs G A 14: 61,207,276 C2257Y probably damaging Het
Sec23a G T 12: 59,005,270 Q90K probably damaging Het
Slc30a6 A G 17: 74,405,690 T61A possibly damaging Het
Slc39a11 C A 11: 113,250,559 A234S probably damaging Het
Smg6 C A 11: 75,156,238 N1252K probably damaging Het
Spata2 A T 2: 167,484,307 D197E probably damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Spocd1 T C 4: 129,948,968 F59L probably damaging Het
Tectb T A 19: 55,192,673 probably benign Het
Tnfrsf22 GCA GCAACA 7: 143,649,553 probably benign Het
Tnfrsf22 AGCCGCCGCC AGCCGCCGCCGCC 7: 143,649,570 probably benign Het
Tnnc1 G A 14: 31,210,605 V82I probably damaging Het
Traf7 A T 17: 24,510,041 V513D probably damaging Het
Vmn2r111 A T 17: 22,571,929 Y129* probably null Het
Vrtn T A 12: 84,649,916 F480Y probably benign Het
Vwa8 A T 14: 79,009,209 I664F probably damaging Het
Vwde A T 6: 13,193,137 V401E probably damaging Het
Zcchc11 T A 4: 108,542,711 probably null Het
Zfp655 A T 5: 145,244,025 N231I probably benign Het
Other mutations in Acvr2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01662:Acvr2b APN 9 119432504 missense probably damaging 1.00
IGL02206:Acvr2b APN 9 119427998 nonsense probably null
IGL03022:Acvr2b APN 9 119427521 missense probably benign 0.10
IGL03131:Acvr2b APN 9 119431284 missense possibly damaging 0.92
R0455:Acvr2b UTSW 9 119432609 missense probably damaging 1.00
R2131:Acvr2b UTSW 9 119432808 missense probably damaging 1.00
R4744:Acvr2b UTSW 9 119431262 missense probably damaging 1.00
R5278:Acvr2b UTSW 9 119432489 missense probably damaging 0.99
R5636:Acvr2b UTSW 9 119428309 missense probably damaging 1.00
R6196:Acvr2b UTSW 9 119433403 missense possibly damaging 0.71
R6253:Acvr2b UTSW 9 119428561 missense probably damaging 1.00
R6424:Acvr2b UTSW 9 119402579 missense probably benign
R6465:Acvr2b UTSW 9 119433303 missense probably damaging 1.00
R7096:Acvr2b UTSW 9 119428189 splice site probably null
R7102:Acvr2b UTSW 9 119432553 missense probably damaging 0.96
R7497:Acvr2b UTSW 9 119433286 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGAATTCCACTCTTACCCAACCTG -3'
(R):5'- TGGACAACCACCTCCTGAAG -3'

Sequencing Primer
(F):5'- TTACCCAACCTGGTGCATGG -3'
(R):5'- TCCAGCGAAGGGTGCTG -3'
Posted On2021-01-18