Incidental Mutation 'R8557:Myrip'
ID 660165
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Name myosin VIIA and Rab interacting protein
Synonyms A230081N12Rik, Slac2-c
MMRRC Submission 068520-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8557 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 120132996-120305167 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 120246252 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 127 (S127G)
Ref Sequence ENSEMBL: ENSMUSP00000122046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121] [ENSMUST00000133173]
AlphaFold Q8K3I4
Predicted Effect probably benign
Transcript: ENSMUST00000048121
AA Change: S127G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794
AA Change: S127G

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133173
AA Change: S127G

PolyPhen 2 Score 0.325 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122046
Gene: ENSMUSG00000041794
AA Change: S127G

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 2.1e-44 PFAM
Pfam:Rab_eff_C 152 210 5.4e-34 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 64,055,954 (GRCm39) V230A probably benign Het
Ablim2 A T 5: 35,985,483 (GRCm39) H260L probably damaging Het
Acp4 C T 7: 43,905,272 (GRCm39) probably null Het
Acvr2b G T 9: 119,261,654 (GRCm39) V416L probably damaging Het
Adipoq A T 16: 22,965,430 (GRCm39) probably benign Het
Amhr2 A G 15: 102,362,847 (GRCm39) Q538R probably benign Het
Apoh C T 11: 108,300,062 (GRCm39) T237I probably damaging Het
Aspm C T 1: 139,384,494 (GRCm39) T97I probably benign Het
Atg16l2 A T 7: 100,939,863 (GRCm39) H499Q probably benign Het
Bicdl2 G A 17: 23,886,536 (GRCm39) R375H probably benign Het
C3 T C 17: 57,531,383 (GRCm39) T304A probably benign Het
Cast A T 13: 74,852,301 (GRCm39) D647E probably damaging Het
Chrm2 T C 6: 36,501,010 (GRCm39) V289A probably benign Het
Clock T C 5: 76,377,217 (GRCm39) D694G probably damaging Het
Cyp4a31 C T 4: 115,427,438 (GRCm39) R215C possibly damaging Het
Dctn2 T C 10: 127,114,062 (GRCm39) L334P probably damaging Het
Dnah11 A G 12: 117,842,247 (GRCm39) I4444T probably benign Het
Egf C A 3: 129,548,600 (GRCm39) R5L unknown Het
Ercc1 A G 7: 19,082,480 (GRCm39) N11S probably benign Het
Eri3 T C 4: 117,472,520 (GRCm39) S113P possibly damaging Het
Fasn A G 11: 120,706,610 (GRCm39) V958A probably benign Het
Fgf10 A G 13: 118,918,132 (GRCm39) K140R probably benign Het
Gfra2 G A 14: 71,214,737 (GRCm39) M163I probably benign Het
Gm14403 T C 2: 177,201,354 (GRCm39) I191T probably damaging Het
Hdlbp T A 1: 93,341,219 (GRCm39) E977D probably damaging Het
Hectd4 A G 5: 121,448,714 (GRCm39) N354S possibly damaging Het
Hpgds A T 6: 65,096,999 (GRCm39) I170N probably benign Het
Limk2 A G 11: 3,296,379 (GRCm39) V356A possibly damaging Het
Map4 A G 9: 109,893,370 (GRCm39) probably null Het
Mettl13 C T 1: 162,371,921 (GRCm39) G316D possibly damaging Het
Mia2 T A 12: 59,148,274 (GRCm39) L45I probably damaging Het
Mier1 T A 4: 102,996,543 (GRCm39) probably null Het
Mob3a G T 10: 80,527,008 (GRCm39) R106S probably benign Het
Mug2 T A 6: 122,040,660 (GRCm39) F737I probably damaging Het
Myo7a C T 7: 97,703,081 (GRCm39) A2053T probably benign Het
Naaladl2 T A 3: 24,262,528 (GRCm39) K395I probably benign Het
Nedd4l A T 18: 65,336,986 (GRCm39) M678L probably benign Het
Nefh A T 11: 4,891,233 (GRCm39) I462N probably damaging Het
Nfe2 A G 15: 103,157,025 (GRCm39) M322T probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,237,059 (GRCm39) probably benign Het
Or2z2 T A 11: 58,346,562 (GRCm39) D71V probably damaging Het
Or56b1 T A 7: 104,285,103 (GRCm39) V74E possibly damaging Het
Pkdcc A G 17: 83,528,495 (GRCm39) N288S probably benign Het
Sacs G A 14: 61,444,725 (GRCm39) C2257Y probably damaging Het
Sec23a G T 12: 59,052,056 (GRCm39) Q90K probably damaging Het
Shisal2a T A 4: 108,225,085 (GRCm39) N159I probably benign Het
Slc30a6 A G 17: 74,712,685 (GRCm39) T61A possibly damaging Het
Slc39a11 C A 11: 113,141,385 (GRCm39) A234S probably damaging Het
Smg6 C A 11: 75,047,064 (GRCm39) N1252K probably damaging Het
Spata2 A T 2: 167,326,227 (GRCm39) D197E probably damaging Het
Spen C T 4: 141,197,681 (GRCm39) A3396T probably benign Het
Spocd1 T C 4: 129,842,761 (GRCm39) F59L probably damaging Het
Tectb T A 19: 55,181,105 (GRCm39) probably benign Het
Tnnc1 G A 14: 30,932,562 (GRCm39) V82I probably damaging Het
Traf7 A T 17: 24,729,015 (GRCm39) V513D probably damaging Het
Tut4 T A 4: 108,399,908 (GRCm39) probably null Het
Vmn2r111 A T 17: 22,790,910 (GRCm39) Y129* probably null Het
Vrtn T A 12: 84,696,690 (GRCm39) F480Y probably benign Het
Vwa8 A T 14: 79,246,649 (GRCm39) I664F probably damaging Het
Vwde A T 6: 13,193,136 (GRCm39) V401E probably damaging Het
Zfp655 A T 5: 145,180,835 (GRCm39) N231I probably benign Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120,217,330 (GRCm39) missense probably damaging 1.00
IGL02108:Myrip APN 9 120,296,631 (GRCm39) critical splice donor site probably null
IGL02406:Myrip APN 9 120,296,598 (GRCm39) missense probably benign
IGL02876:Myrip APN 9 120,261,740 (GRCm39) missense probably damaging 1.00
IGL03109:Myrip APN 9 120,282,790 (GRCm39) splice site probably null
IGL03258:Myrip APN 9 120,270,418 (GRCm39) missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120,296,583 (GRCm39) missense probably damaging 0.98
R0485:Myrip UTSW 9 120,270,443 (GRCm39) missense probably benign 0.01
R0633:Myrip UTSW 9 120,217,302 (GRCm39) missense probably damaging 1.00
R1489:Myrip UTSW 9 120,261,595 (GRCm39) missense probably damaging 1.00
R1539:Myrip UTSW 9 120,253,689 (GRCm39) missense probably benign 0.00
R1708:Myrip UTSW 9 120,293,840 (GRCm39) missense possibly damaging 0.65
R1817:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1818:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1878:Myrip UTSW 9 120,253,721 (GRCm39) missense probably damaging 0.99
R2484:Myrip UTSW 9 120,253,685 (GRCm39) missense probably benign 0.00
R3237:Myrip UTSW 9 120,270,473 (GRCm39) missense possibly damaging 0.91
R3890:Myrip UTSW 9 120,251,324 (GRCm39) missense probably damaging 1.00
R3912:Myrip UTSW 9 120,261,682 (GRCm39) missense probably benign
R3919:Myrip UTSW 9 120,261,695 (GRCm39) missense probably damaging 1.00
R4125:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4126:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4128:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4435:Myrip UTSW 9 120,164,680 (GRCm39) start gained probably benign
R4599:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
R5014:Myrip UTSW 9 120,251,534 (GRCm39) missense probably damaging 1.00
R5665:Myrip UTSW 9 120,290,499 (GRCm39) missense probably damaging 1.00
R5814:Myrip UTSW 9 120,253,734 (GRCm39) missense probably benign 0.06
R5849:Myrip UTSW 9 120,282,759 (GRCm39) missense probably damaging 0.99
R5986:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R6706:Myrip UTSW 9 120,217,359 (GRCm39) missense possibly damaging 0.93
R7019:Myrip UTSW 9 120,251,573 (GRCm39) missense probably damaging 1.00
R7291:Myrip UTSW 9 120,246,207 (GRCm39) missense probably damaging 0.97
R8204:Myrip UTSW 9 120,262,045 (GRCm39) critical splice donor site probably null
R8853:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R8911:Myrip UTSW 9 120,270,484 (GRCm39) missense possibly damaging 0.94
R9106:Myrip UTSW 9 120,261,544 (GRCm39) missense probably benign 0.37
R9225:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
Z1177:Myrip UTSW 9 120,270,547 (GRCm39) missense probably damaging 1.00
Z1177:Myrip UTSW 9 120,261,844 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACAGATAGAAGGCTCCCC -3'
(R):5'- GCTGAGTTAAAACCCGACACTC -3'

Sequencing Primer
(F):5'- CCAAAGTATCCAAAGTTTCTGGCG -3'
(R):5'- GACAAGTTTCTCTGTCTCTATGAAG -3'
Posted On 2021-01-18