Incidental Mutation 'R8557:Sec23a'
ID660175
Institutional Source Beutler Lab
Gene Symbol Sec23a
Ensembl Gene ENSMUSG00000020986
Gene NameSEC23 homolog A, COPII coat complex component
SynonymsSec23r, Msec23
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.479) question?
Stock #R8557 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location58958383-59012017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 59005270 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 90 (Q90K)
Ref Sequence ENSEMBL: ENSMUSP00000126011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021375] [ENSMUST00000165134]
Predicted Effect probably benign
Transcript: ENSMUST00000021375
AA Change: Q90K

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000021375
Gene: ENSMUSG00000020986
AA Change: Q90K

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 58 98 2.7e-17 PFAM
Pfam:Sec23_trunk 126 390 2e-81 PFAM
Pfam:Sec23_BS 401 504 3.2e-35 PFAM
Pfam:Sec23_helical 520 618 1e-30 PFAM
Pfam:Gelsolin 629 718 9.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165134
AA Change: Q90K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126011
Gene: ENSMUSG00000020986
AA Change: Q90K

DomainStartEndE-ValueType
Pfam:zf-Sec23_Sec24 57 98 8.1e-16 PFAM
Pfam:Sec23_trunk 97 361 6.5e-84 PFAM
Pfam:Sec23_BS 372 475 3.8e-36 PFAM
Pfam:Sec23_helical 490 590 1.6e-38 PFAM
Pfam:Gelsolin 599 689 2.7e-17 PFAM
Meta Mutation Damage Score 0.1737 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC23 subfamily of the SEC23/SEC24 family. It is part of a protein complex and found in the ribosome-free transitional face of the endoplasmic reticulum (ER) and associated vesicles. This protein has similarity to yeast Sec23p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The encoded protein is suggested to play a role in the ER-Golgi protein trafficking. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele die during mid-embryogenesis exhibiting defects in neural tube closure and extraembryonic membrane formation as well as broad secretion defects of multiple collagen species in different tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,611 V230A probably benign Het
Ablim2 A T 5: 35,828,139 H260L probably damaging Het
Acp4 C T 7: 44,255,848 probably null Het
Acvr2b G T 9: 119,432,588 V416L probably damaging Het
Adipoq A T 16: 23,146,680 probably benign Het
Amhr2 A G 15: 102,454,412 Q538R probably benign Het
Apoh C T 11: 108,409,236 T237I probably damaging Het
Aspm C T 1: 139,456,756 T97I probably benign Het
Atg16l2 A T 7: 101,290,656 H499Q probably benign Het
Bicdl2 G A 17: 23,667,562 R375H probably benign Het
C3 T C 17: 57,224,383 T304A probably benign Het
Cast A T 13: 74,704,182 D647E probably damaging Het
Chrm2 T C 6: 36,524,075 V289A probably benign Het
Clock T C 5: 76,229,370 D694G probably damaging Het
Cyp4a31 C T 4: 115,570,241 R215C possibly damaging Het
Dctn2 T C 10: 127,278,193 L334P probably damaging Het
Dnah11 A G 12: 117,878,512 I4444T probably benign Het
Egf C A 3: 129,754,951 R5L unknown Het
Ercc1 A G 7: 19,348,555 N11S probably benign Het
Eri3 T C 4: 117,615,323 S113P possibly damaging Het
Fam159a T A 4: 108,367,888 N159I probably benign Het
Fasn A G 11: 120,815,784 V958A probably benign Het
Fgf10 A G 13: 118,781,596 K140R probably benign Het
Gfra2 G A 14: 70,977,297 M163I probably benign Het
Gm14403 T C 2: 177,509,561 I191T probably damaging Het
Hdlbp T A 1: 93,413,497 E977D probably damaging Het
Hectd4 A G 5: 121,310,651 N354S possibly damaging Het
Hpgds A T 6: 65,120,015 I170N probably benign Het
Limk2 A G 11: 3,346,379 V356A possibly damaging Het
Map4 A G 9: 110,064,302 probably null Het
Mettl13 C T 1: 162,544,352 G316D possibly damaging Het
Mia2 T A 12: 59,101,488 L45I probably damaging Het
Mier1 T A 4: 103,139,346 probably null Het
Mob3a G T 10: 80,691,174 R106S probably benign Het
Mug2 T A 6: 122,063,701 F737I probably damaging Het
Myo7a C T 7: 98,053,874 A2053T probably benign Het
Myrip A G 9: 120,417,186 S127G probably benign Het
Naaladl2 T A 3: 24,208,364 K395I probably benign Het
Nedd4l A T 18: 65,203,915 M678L probably benign Het
Nefh A T 11: 4,941,233 I462N probably damaging Het
Nfe2 A G 15: 103,248,598 M322T probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr30 T A 11: 58,455,736 D71V probably damaging Het
Olfr657 T A 7: 104,635,896 V74E possibly damaging Het
Pkdcc A G 17: 83,221,066 N288S probably benign Het
Sacs G A 14: 61,207,276 C2257Y probably damaging Het
Slc30a6 A G 17: 74,405,690 T61A possibly damaging Het
Slc39a11 C A 11: 113,250,559 A234S probably damaging Het
Smg6 C A 11: 75,156,238 N1252K probably damaging Het
Spata2 A T 2: 167,484,307 D197E probably damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Spocd1 T C 4: 129,948,968 F59L probably damaging Het
Tectb T A 19: 55,192,673 probably benign Het
Tnnc1 G A 14: 31,210,605 V82I probably damaging Het
Traf7 A T 17: 24,510,041 V513D probably damaging Het
Vmn2r111 A T 17: 22,571,929 Y129* probably null Het
Vrtn T A 12: 84,649,916 F480Y probably benign Het
Vwa8 A T 14: 79,009,209 I664F probably damaging Het
Vwde A T 6: 13,193,137 V401E probably damaging Het
Zcchc11 T A 4: 108,542,711 probably null Het
Zfp655 A T 5: 145,244,025 N231I probably benign Het
Other mutations in Sec23a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Sec23a APN 12 58992282 missense possibly damaging 0.47
IGL01836:Sec23a APN 12 58971287 missense probably damaging 0.98
IGL01906:Sec23a APN 12 59007044 missense probably damaging 1.00
IGL02383:Sec23a APN 12 59002027 missense probably damaging 1.00
IGL02507:Sec23a APN 12 59007098 missense probably benign 0.34
IGL02816:Sec23a APN 12 58978545 missense probably benign 0.03
IGL03060:Sec23a APN 12 58986105 missense probably benign
R0308:Sec23a UTSW 12 59007199 nonsense probably null
R0361:Sec23a UTSW 12 58991018 missense probably damaging 1.00
R0546:Sec23a UTSW 12 58985167 missense probably benign 0.07
R0720:Sec23a UTSW 12 58971271 missense probably damaging 1.00
R1084:Sec23a UTSW 12 58985135 missense probably damaging 0.97
R1156:Sec23a UTSW 12 59001836 missense probably benign
R1438:Sec23a UTSW 12 59002010 missense probably damaging 0.98
R1446:Sec23a UTSW 12 58978559 missense probably damaging 1.00
R1526:Sec23a UTSW 12 58986186 splice site probably null
R1705:Sec23a UTSW 12 59001866 missense possibly damaging 0.95
R1997:Sec23a UTSW 12 59002007 missense probably benign
R2051:Sec23a UTSW 12 58990968 splice site probably null
R2081:Sec23a UTSW 12 58998281 nonsense probably null
R4201:Sec23a UTSW 12 59002005 missense probably benign 0.00
R4706:Sec23a UTSW 12 58982586 missense probably damaging 0.98
R4724:Sec23a UTSW 12 58978506 missense probably damaging 0.99
R4969:Sec23a UTSW 12 59004488 critical splice donor site probably null
R5375:Sec23a UTSW 12 59007005 missense probably benign 0.15
R5858:Sec23a UTSW 12 58973035 missense probably damaging 0.98
R6539:Sec23a UTSW 12 58985212 missense probably benign 0.00
R6558:Sec23a UTSW 12 59004552 missense probably benign 0.03
R6616:Sec23a UTSW 12 58997155 missense possibly damaging 0.95
R6716:Sec23a UTSW 12 58968823 missense probably benign 0.09
R7078:Sec23a UTSW 12 58992283 missense probably benign 0.07
R7155:Sec23a UTSW 12 58989443 missense probably benign 0.03
R7367:Sec23a UTSW 12 58966999 missense probably benign
R7923:Sec23a UTSW 12 58992247 missense probably damaging 0.99
R8178:Sec23a UTSW 12 59007194 missense possibly damaging 0.93
Z1088:Sec23a UTSW 12 59004576 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGCCAGAAACAGAAATACAGTTT -3'
(R):5'- AACCCATTCTCAGGGTACAGTT -3'

Sequencing Primer
(F):5'- GGTGCAAGCTTTTAATCCCAG -3'
(R):5'- TAAGGCTCGGGGTTCAACTC -3'
Posted On2021-01-18