Incidental Mutation 'R8557:Cast'
ID660179
Institutional Source Beutler Lab
Gene Symbol Cast
Ensembl Gene ENSMUSG00000021585
Gene Namecalpastatin
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8557 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location74692368-74808810 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74704182 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 647 (D647E)
Ref Sequence ENSEMBL: ENSMUSP00000152174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065629] [ENSMUST00000220738] [ENSMUST00000222588] [ENSMUST00000223033] [ENSMUST00000223126] [ENSMUST00000223206] [ENSMUST00000223309]
Predicted Effect probably damaging
Transcript: ENSMUST00000065629
AA Change: D613E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000065275
Gene: ENSMUSG00000021585
AA Change: D613E

DomainStartEndE-ValueType
Pfam:Calpain_inhib 15 272 8.1e-9 PFAM
Pfam:Calpain_inhib 279 404 2.7e-36 PFAM
Pfam:Calpain_inhib 415 544 3.6e-38 PFAM
Pfam:Calpain_inhib 556 684 4.5e-36 PFAM
low complexity region 708 744 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220738
AA Change: D304E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000222588
AA Change: D545E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223033
AA Change: D563E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223126
AA Change: D545E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223206
AA Change: D647E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000223309
AA Change: D290E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an inhibitor of the calcium-dependent cysteine protease, calpain. This protein plays roles in multiple processes, including apoptosis, cell cycle regulation, and membrane fusion. Multiple protein isoforms exist which contain unique N-terminal domains, and multiple inhibitory domains that share homology with each other. Some isoforms may be tissue-specific. Two different pseudogenes of this gene are found on chromosome 19. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knockout allele exhibit augmented DNA fragmentation in CA1 pyramidal neurons following excitotoxic kainate treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,611 V230A probably benign Het
Ablim2 A T 5: 35,828,139 H260L probably damaging Het
Acp4 C T 7: 44,255,848 probably null Het
Acvr2b G T 9: 119,432,588 V416L probably damaging Het
Adipoq A T 16: 23,146,680 probably benign Het
Amhr2 A G 15: 102,454,412 Q538R probably benign Het
Apoh C T 11: 108,409,236 T237I probably damaging Het
Aspm C T 1: 139,456,756 T97I probably benign Het
Atg16l2 A T 7: 101,290,656 H499Q probably benign Het
Bicdl2 G A 17: 23,667,562 R375H probably benign Het
C3 T C 17: 57,224,383 T304A probably benign Het
Chrm2 T C 6: 36,524,075 V289A probably benign Het
Clock T C 5: 76,229,370 D694G probably damaging Het
Cyp4a31 C T 4: 115,570,241 R215C possibly damaging Het
Dctn2 T C 10: 127,278,193 L334P probably damaging Het
Dnah11 A G 12: 117,878,512 I4444T probably benign Het
Egf C A 3: 129,754,951 R5L unknown Het
Ercc1 A G 7: 19,348,555 N11S probably benign Het
Eri3 T C 4: 117,615,323 S113P possibly damaging Het
Fam159a T A 4: 108,367,888 N159I probably benign Het
Fasn A G 11: 120,815,784 V958A probably benign Het
Fgf10 A G 13: 118,781,596 K140R probably benign Het
Gfra2 G A 14: 70,977,297 M163I probably benign Het
Gm14403 T C 2: 177,509,561 I191T probably damaging Het
Hdlbp T A 1: 93,413,497 E977D probably damaging Het
Hectd4 A G 5: 121,310,651 N354S possibly damaging Het
Hpgds A T 6: 65,120,015 I170N probably benign Het
Limk2 A G 11: 3,346,379 V356A possibly damaging Het
Mettl13 C T 1: 162,544,352 G316D possibly damaging Het
Mia2 T A 12: 59,101,488 L45I probably damaging Het
Mob3a G T 10: 80,691,174 R106S probably benign Het
Mug2 T A 6: 122,063,701 F737I probably damaging Het
Myo7a C T 7: 98,053,874 A2053T probably benign Het
Myrip A G 9: 120,417,186 S127G probably benign Het
Naaladl2 T A 3: 24,208,364 K395I probably benign Het
Nedd4l A T 18: 65,203,915 M678L probably benign Het
Nefh A T 11: 4,941,233 I462N probably damaging Het
Nfe2 A G 15: 103,248,598 M322T probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr30 T A 11: 58,455,736 D71V probably damaging Het
Olfr657 T A 7: 104,635,896 V74E possibly damaging Het
Pkdcc A G 17: 83,221,066 N288S probably benign Het
Sacs G A 14: 61,207,276 C2257Y probably damaging Het
Sec23a G T 12: 59,005,270 Q90K probably damaging Het
Slc30a6 A G 17: 74,405,690 T61A possibly damaging Het
Slc39a11 C A 11: 113,250,559 A234S probably damaging Het
Smg6 C A 11: 75,156,238 N1252K probably damaging Het
Spata2 A T 2: 167,484,307 D197E probably damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Spocd1 T C 4: 129,948,968 F59L probably damaging Het
Tectb T A 19: 55,192,673 probably benign Het
Tnfrsf22 GCA GCAACA 7: 143,649,553 probably benign Het
Tnfrsf22 AGCCGCCGCC AGCCGCCGCCGCC 7: 143,649,570 probably benign Het
Tnnc1 G A 14: 31,210,605 V82I probably damaging Het
Traf7 A T 17: 24,510,041 V513D probably damaging Het
Vmn2r111 A T 17: 22,571,929 Y129* probably null Het
Vrtn T A 12: 84,649,916 F480Y probably benign Het
Vwa8 A T 14: 79,009,209 I664F probably damaging Het
Vwde A T 6: 13,193,137 V401E probably damaging Het
Zcchc11 T A 4: 108,542,711 probably null Het
Zfp655 A T 5: 145,244,025 N231I probably benign Het
Other mutations in Cast
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Cast APN 13 74736974 missense probably damaging 1.00
IGL01363:Cast APN 13 74704192 missense possibly damaging 0.95
IGL01404:Cast APN 13 74738287 nonsense probably null
IGL01893:Cast APN 13 74727289 nonsense probably null
IGL02139:Cast APN 13 74728365 missense possibly damaging 0.80
IGL02444:Cast APN 13 74739853 missense probably damaging 1.00
IGL02927:Cast APN 13 74736994 missense probably damaging 1.00
IGL02941:Cast APN 13 74700687 missense probably damaging 1.00
IGL02799:Cast UTSW 13 74736752 missense probably damaging 1.00
R0583:Cast UTSW 13 74713678 missense probably damaging 0.99
R2031:Cast UTSW 13 74798652 splice site probably null
R2256:Cast UTSW 13 74739905 missense probably damaging 0.99
R2509:Cast UTSW 13 74737616 missense probably benign 0.19
R3923:Cast UTSW 13 74728413 missense probably damaging 1.00
R4116:Cast UTSW 13 74724837 missense probably damaging 1.00
R4649:Cast UTSW 13 74746014 missense probably benign 0.25
R4651:Cast UTSW 13 74746014 missense probably benign 0.25
R4652:Cast UTSW 13 74746014 missense probably benign 0.25
R4653:Cast UTSW 13 74746014 missense probably benign 0.25
R4714:Cast UTSW 13 74798715 missense probably damaging 1.00
R4751:Cast UTSW 13 74746047 missense probably damaging 1.00
R4758:Cast UTSW 13 74739880 missense possibly damaging 0.90
R4974:Cast UTSW 13 74807823 missense probably benign
R5040:Cast UTSW 13 74724813 missense probably damaging 1.00
R5397:Cast UTSW 13 74720937 missense possibly damaging 0.83
R5556:Cast UTSW 13 74695889 critical splice donor site probably null
R5863:Cast UTSW 13 74736756 missense probably damaging 1.00
R6030:Cast UTSW 13 74695937 missense possibly damaging 0.83
R6030:Cast UTSW 13 74695937 missense possibly damaging 0.83
R6349:Cast UTSW 13 74721195 missense probably damaging 1.00
R6817:Cast UTSW 13 74699158 missense possibly damaging 0.78
R6829:Cast UTSW 13 74728344 missense possibly damaging 0.50
R6848:Cast UTSW 13 74695933 missense possibly damaging 0.66
R7275:Cast UTSW 13 74727334 missense probably benign 0.00
R7401:Cast UTSW 13 74808458 missense unknown
R7408:Cast UTSW 13 74739841 missense probably damaging 0.99
R7602:Cast UTSW 13 74736965 missense probably benign 0.26
R8032:Cast UTSW 13 74735241 nonsense probably null
R8499:Cast UTSW 13 74798716 missense probably benign 0.07
R8544:Cast UTSW 13 74734058 missense possibly damaging 0.92
R8709:Cast UTSW 13 74744661 missense not run
X0011:Cast UTSW 13 74725456 missense probably damaging 1.00
X0066:Cast UTSW 13 74736979 missense probably damaging 1.00
Z1177:Cast UTSW 13 74725463 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTCGTGCAATGGAATCTGTTC -3'
(R):5'- TTTCCCTGTCAGCACATCAG -3'

Sequencing Primer
(F):5'- CTGAAACAAGAAAATGAGATGGAGC -3'
(R):5'- CACATCAGTTTTCCAATACTGACTGG -3'
Posted On2021-01-18