Incidental Mutation 'R8557:Adipoq'
ID660187
Institutional Source Beutler Lab
Gene Symbol Adipoq
Ensembl Gene ENSMUSG00000022878
Gene Nameadiponectin, C1Q and collagen domain containing
SynonymsAcdc, adiponectin, GBP28, APN, adipo, Acrp30, apM1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R8557 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location23146536-23158028 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 23146680 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023593] [ENSMUST00000171309]
PDB Structure THE CRYSTAL STRUCTURE OF A COMPLMENT-1Q FAMILY PROTEIN SUGGESTS AN EVOLUTIONARY LINK TO TUMOR NECROSIS FACTOR [X-RAY DIFFRACTION]
ACRP30 CALCIUM COMPLEX [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000023593
SMART Domains Protein: ENSMUSP00000023593
Gene: ENSMUSG00000022878

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
internal_repeat_1 45 74 2.54e-5 PROSPERO
C1Q 109 245 2.81e-69 SMART
Predicted Effect unknown
Transcript: ENSMUST00000171309
AA Change: M1L
SMART Domains Protein: ENSMUSP00000126793
Gene: ENSMUSG00000022878
AA Change: M1L

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Collagen 61 133 1.4e-11 PFAM
SCOP:d1gr3a_ 134 168 2e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is expressed in adipose tissue exclusively. It encodes a protein with similarity to collagens X and VIII and complement factor C1q. The encoded protein circulates in the plasma and is involved with metabolic and hormonal processes. Mutations in this gene are associated with adiponectin deficiency. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased beta-oxidation in muscle and liver, impaired free fatty acid clearance, and moderate insulin resistance. Heterozygotes show mild insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,611 V230A probably benign Het
Ablim2 A T 5: 35,828,139 H260L probably damaging Het
Acp4 C T 7: 44,255,848 probably null Het
Acvr2b G T 9: 119,432,588 V416L probably damaging Het
Amhr2 A G 15: 102,454,412 Q538R probably benign Het
Apoh C T 11: 108,409,236 T237I probably damaging Het
Aspm C T 1: 139,456,756 T97I probably benign Het
Atg16l2 A T 7: 101,290,656 H499Q probably benign Het
Bicdl2 G A 17: 23,667,562 R375H probably benign Het
C3 T C 17: 57,224,383 T304A probably benign Het
Cast A T 13: 74,704,182 D647E probably damaging Het
Chrm2 T C 6: 36,524,075 V289A probably benign Het
Clock T C 5: 76,229,370 D694G probably damaging Het
Cyp4a31 C T 4: 115,570,241 R215C possibly damaging Het
Dctn2 T C 10: 127,278,193 L334P probably damaging Het
Dnah11 A G 12: 117,878,512 I4444T probably benign Het
Egf C A 3: 129,754,951 R5L unknown Het
Ercc1 A G 7: 19,348,555 N11S probably benign Het
Eri3 T C 4: 117,615,323 S113P possibly damaging Het
Fam159a T A 4: 108,367,888 N159I probably benign Het
Fasn A G 11: 120,815,784 V958A probably benign Het
Fgf10 A G 13: 118,781,596 K140R probably benign Het
Gfra2 G A 14: 70,977,297 M163I probably benign Het
Gm14403 T C 2: 177,509,561 I191T probably damaging Het
Hdlbp T A 1: 93,413,497 E977D probably damaging Het
Hectd4 A G 5: 121,310,651 N354S possibly damaging Het
Hpgds A T 6: 65,120,015 I170N probably benign Het
Limk2 A G 11: 3,346,379 V356A possibly damaging Het
Mettl13 C T 1: 162,544,352 G316D possibly damaging Het
Mia2 T A 12: 59,101,488 L45I probably damaging Het
Mob3a G T 10: 80,691,174 R106S probably benign Het
Mug2 T A 6: 122,063,701 F737I probably damaging Het
Myo7a C T 7: 98,053,874 A2053T probably benign Het
Myrip A G 9: 120,417,186 S127G probably benign Het
Naaladl2 T A 3: 24,208,364 K395I probably benign Het
Nedd4l A T 18: 65,203,915 M678L probably benign Het
Nefh A T 11: 4,941,233 I462N probably damaging Het
Nfe2 A G 15: 103,248,598 M322T probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr30 T A 11: 58,455,736 D71V probably damaging Het
Olfr657 T A 7: 104,635,896 V74E possibly damaging Het
Pkdcc A G 17: 83,221,066 N288S probably benign Het
Sacs G A 14: 61,207,276 C2257Y probably damaging Het
Sec23a G T 12: 59,005,270 Q90K probably damaging Het
Slc30a6 A G 17: 74,405,690 T61A possibly damaging Het
Slc39a11 C A 11: 113,250,559 A234S probably damaging Het
Smg6 C A 11: 75,156,238 N1252K probably damaging Het
Spata2 A T 2: 167,484,307 D197E probably damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Spocd1 T C 4: 129,948,968 F59L probably damaging Het
Tectb T A 19: 55,192,673 probably benign Het
Tnfrsf22 GCA GCAACA 7: 143,649,553 probably benign Het
Tnfrsf22 AGCCGCCGCC AGCCGCCGCCGCC 7: 143,649,570 probably benign Het
Tnnc1 G A 14: 31,210,605 V82I probably damaging Het
Traf7 A T 17: 24,510,041 V513D probably damaging Het
Vmn2r111 A T 17: 22,571,929 Y129* probably null Het
Vrtn T A 12: 84,649,916 F480Y probably benign Het
Vwa8 A T 14: 79,009,209 I664F probably damaging Het
Vwde A T 6: 13,193,137 V401E probably damaging Het
Zcchc11 T A 4: 108,542,711 probably null Het
Zfp655 A T 5: 145,244,025 N231I probably benign Het
Other mutations in Adipoq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02686:Adipoq APN 16 23157115 missense possibly damaging 0.64
R0196:Adipoq UTSW 16 23146643 splice site probably null
R0617:Adipoq UTSW 16 23155410 missense probably damaging 1.00
R1773:Adipoq UTSW 16 23155238 missense unknown
R2284:Adipoq UTSW 16 23157487 nonsense probably null
R2367:Adipoq UTSW 16 23155319 missense probably benign 0.05
R3767:Adipoq UTSW 16 23157188 missense possibly damaging 0.83
R7670:Adipoq UTSW 16 23157582 missense probably damaging 0.99
X0026:Adipoq UTSW 16 23155284 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCCACTCATTGGCTATTGG -3'
(R):5'- ATCCTGCCATCAAATGAACAGGG -3'

Sequencing Primer
(F):5'- GCCTTGACTGGGTTGGCC -3'
(R):5'- AACTTCCGGTTAGGCTCAAG -3'
Posted On2021-01-18