Incidental Mutation 'R8557:C3'
ID660191
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Namecomplement component 3
Synonymscomplement factor 3, acylation stimulating protein, Plp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8557 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57203970-57228136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57224383 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 304 (T304A)
Ref Sequence ENSEMBL: ENSMUSP00000024988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
Predicted Effect probably benign
Transcript: ENSMUST00000024988
AA Change: T304A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: T304A

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177046
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik T C 5: 63,898,611 V230A probably benign Het
Ablim2 A T 5: 35,828,139 H260L probably damaging Het
Acp4 C T 7: 44,255,848 probably null Het
Acvr2b G T 9: 119,432,588 V416L probably damaging Het
Adipoq A T 16: 23,146,680 probably benign Het
Amhr2 A G 15: 102,454,412 Q538R probably benign Het
Apoh C T 11: 108,409,236 T237I probably damaging Het
Aspm C T 1: 139,456,756 T97I probably benign Het
Atg16l2 A T 7: 101,290,656 H499Q probably benign Het
Bicdl2 G A 17: 23,667,562 R375H probably benign Het
Cast A T 13: 74,704,182 D647E probably damaging Het
Chrm2 T C 6: 36,524,075 V289A probably benign Het
Clock T C 5: 76,229,370 D694G probably damaging Het
Cyp4a31 C T 4: 115,570,241 R215C possibly damaging Het
Dctn2 T C 10: 127,278,193 L334P probably damaging Het
Dnah11 A G 12: 117,878,512 I4444T probably benign Het
Egf C A 3: 129,754,951 R5L unknown Het
Ercc1 A G 7: 19,348,555 N11S probably benign Het
Eri3 T C 4: 117,615,323 S113P possibly damaging Het
Fam159a T A 4: 108,367,888 N159I probably benign Het
Fasn A G 11: 120,815,784 V958A probably benign Het
Fgf10 A G 13: 118,781,596 K140R probably benign Het
Gfra2 G A 14: 70,977,297 M163I probably benign Het
Gm14403 T C 2: 177,509,561 I191T probably damaging Het
Hdlbp T A 1: 93,413,497 E977D probably damaging Het
Hectd4 A G 5: 121,310,651 N354S possibly damaging Het
Hpgds A T 6: 65,120,015 I170N probably benign Het
Limk2 A G 11: 3,346,379 V356A possibly damaging Het
Map4 A G 9: 110,064,302 probably null Het
Mettl13 C T 1: 162,544,352 G316D possibly damaging Het
Mia2 T A 12: 59,101,488 L45I probably damaging Het
Mier1 T A 4: 103,139,346 probably null Het
Mob3a G T 10: 80,691,174 R106S probably benign Het
Mug2 T A 6: 122,063,701 F737I probably damaging Het
Myo7a C T 7: 98,053,874 A2053T probably benign Het
Myrip A G 9: 120,417,186 S127G probably benign Het
Naaladl2 T A 3: 24,208,364 K395I probably benign Het
Nedd4l A T 18: 65,203,915 M678L probably benign Het
Nefh A T 11: 4,941,233 I462N probably damaging Het
Nfe2 A G 15: 103,248,598 M322T probably benign Het
Ogfr GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG 2: 180,595,266 probably benign Het
Olfr30 T A 11: 58,455,736 D71V probably damaging Het
Olfr657 T A 7: 104,635,896 V74E possibly damaging Het
Pkdcc A G 17: 83,221,066 N288S probably benign Het
Sacs G A 14: 61,207,276 C2257Y probably damaging Het
Sec23a G T 12: 59,005,270 Q90K probably damaging Het
Slc30a6 A G 17: 74,405,690 T61A possibly damaging Het
Slc39a11 C A 11: 113,250,559 A234S probably damaging Het
Smg6 C A 11: 75,156,238 N1252K probably damaging Het
Spata2 A T 2: 167,484,307 D197E probably damaging Het
Spen C T 4: 141,470,370 A3396T probably benign Het
Spocd1 T C 4: 129,948,968 F59L probably damaging Het
Tectb T A 19: 55,192,673 probably benign Het
Tnnc1 G A 14: 31,210,605 V82I probably damaging Het
Traf7 A T 17: 24,510,041 V513D probably damaging Het
Vmn2r111 A T 17: 22,571,929 Y129* probably null Het
Vrtn T A 12: 84,649,916 F480Y probably benign Het
Vwa8 A T 14: 79,009,209 I664F probably damaging Het
Vwde A T 6: 13,193,137 V401E probably damaging Het
Zcchc11 T A 4: 108,542,711 probably null Het
Zfp655 A T 5: 145,244,025 N231I probably benign Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57226004 missense probably benign 0.01
IGL00741:C3 APN 17 57220206 intron probably benign
IGL01093:C3 APN 17 57223949 missense probably damaging 1.00
IGL01309:C3 APN 17 57209652 intron probably benign
IGL01312:C3 APN 17 57225993 unclassified probably benign
IGL01344:C3 APN 17 57224880 missense probably benign
IGL01514:C3 APN 17 57215866 missense probably benign 0.04
IGL01913:C3 APN 17 57213767 missense probably null 0.01
IGL02165:C3 APN 17 57225092 missense probably benign 0.17
IGL02176:C3 APN 17 57226337 unclassified probably benign
IGL02189:C3 APN 17 57220113 missense probably benign 0.01
IGL02378:C3 APN 17 57212698 missense probably benign 0.19
IGL02422:C3 APN 17 57226823 missense probably damaging 0.98
IGL02715:C3 APN 17 57204158 intron probably benign
IGL02737:C3 APN 17 57204281 missense probably benign 0.08
IGL03201:C3 APN 17 57222249 missense probably damaging 1.00
IGL03210:C3 APN 17 57215846 nonsense probably null
IGL03345:C3 APN 17 57219585 missense probably damaging 1.00
PIT4431001:C3 UTSW 17 57206242 missense probably benign 0.00
PIT4494001:C3 UTSW 17 57209263 missense probably benign 0.01
R0158:C3 UTSW 17 57224851 critical splice donor site probably null
R0318:C3 UTSW 17 57224709 missense probably damaging 0.99
R1132:C3 UTSW 17 57207531 critical splice donor site probably null
R1765:C3 UTSW 17 57224401 splice site probably null
R1793:C3 UTSW 17 57219592 missense possibly damaging 0.93
R1852:C3 UTSW 17 57222823 missense probably damaging 0.98
R1908:C3 UTSW 17 57209489 missense probably damaging 1.00
R1919:C3 UTSW 17 57220135 missense probably damaging 1.00
R1935:C3 UTSW 17 57218829 missense probably damaging 1.00
R2026:C3 UTSW 17 57218562 missense probably damaging 1.00
R2108:C3 UTSW 17 57223974 splice site probably null
R2197:C3 UTSW 17 57219623 missense probably benign 0.32
R2394:C3 UTSW 17 57222303 nonsense probably null
R2998:C3 UTSW 17 57210284 missense probably benign 0.00
R3727:C3 UTSW 17 57207379 missense possibly damaging 0.50
R3767:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3768:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3769:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3770:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3784:C3 UTSW 17 57226067 missense probably damaging 0.99
R3883:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3884:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3950:C3 UTSW 17 57225286 missense probably benign 0.02
R3966:C3 UTSW 17 57218664 missense probably damaging 0.99
R4077:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4078:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4079:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4168:C3 UTSW 17 57218608 missense probably benign 0.00
R4208:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4695:C3 UTSW 17 57221057 missense probably benign
R4909:C3 UTSW 17 57226830 critical splice donor site probably null
R5011:C3 UTSW 17 57223236 missense probably benign 0.06
R5094:C3 UTSW 17 57225033 critical splice donor site probably null
R5141:C3 UTSW 17 57219570 missense probably damaging 0.98
R5170:C3 UTSW 17 57223938 missense probably damaging 0.96
R5339:C3 UTSW 17 57224308 missense probably damaging 0.99
R5369:C3 UTSW 17 57221159 missense probably benign 0.45
R5412:C3 UTSW 17 57220187 missense probably benign 0.01
R5439:C3 UTSW 17 57204502 missense probably benign 0.28
R5463:C3 UTSW 17 57211720 missense probably benign 0.08
R5546:C3 UTSW 17 57222976 missense probably damaging 0.99
R5572:C3 UTSW 17 57224673 missense probably damaging 0.99
R5851:C3 UTSW 17 57211612 missense probably null 0.14
R5863:C3 UTSW 17 57223141 missense probably benign 0.06
R5888:C3 UTSW 17 57214831 missense probably damaging 1.00
R5940:C3 UTSW 17 57210244 missense possibly damaging 0.64
R6073:C3 UTSW 17 57206223 missense probably null
R6091:C3 UTSW 17 57221967 nonsense probably null
R6286:C3 UTSW 17 57224118 missense probably damaging 1.00
R6524:C3 UTSW 17 57217264 critical splice donor site probably null
R6868:C3 UTSW 17 57204029 missense possibly damaging 0.55
R6896:C3 UTSW 17 57220864 splice site probably null
R7007:C3 UTSW 17 57218809 missense probably benign 0.00
R7022:C3 UTSW 17 57217286 missense probably damaging 1.00
R7099:C3 UTSW 17 57206276 missense probably benign 0.28
R7117:C3 UTSW 17 57212655 missense probably benign 0.01
R7347:C3 UTSW 17 57223215 missense probably benign 0.09
R7366:C3 UTSW 17 57221162 missense probably benign 0.00
R7423:C3 UTSW 17 57214767 missense probably damaging 1.00
R7425:C3 UTSW 17 57204039 missense possibly damaging 0.81
R7481:C3 UTSW 17 57220136 missense probably damaging 1.00
R7540:C3 UTSW 17 57206220 missense probably benign 0.01
R7746:C3 UTSW 17 57218859 missense probably damaging 1.00
R7771:C3 UTSW 17 57215797 missense probably damaging 1.00
R7884:C3 UTSW 17 57226264 missense probably benign 0.05
R8144:C3 UTSW 17 57226276 missense probably damaging 0.98
R8279:C3 UTSW 17 57215809 missense probably benign 0.28
R8284:C3 UTSW 17 57223938 missense probably benign 0.39
R8328:C3 UTSW 17 57220973 missense probably benign 0.00
R8353:C3 UTSW 17 57212643 missense probably benign 0.00
R8396:C3 UTSW 17 57221029 missense probably benign
R8429:C3 UTSW 17 57222811 missense probably damaging 1.00
R8453:C3 UTSW 17 57212643 missense probably benign 0.00
R8738:C3 UTSW 17 57204015 makesense probably null
R8794:C3 UTSW 17 57221011 missense probably benign
Z1177:C3 UTSW 17 57217144 missense probably benign 0.07
Z1177:C3 UTSW 17 57226171 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGGCAGGCTTCCCAAAAG -3'
(R):5'- TTAGAATGGCAGCCTCTCCC -3'

Sequencing Primer
(F):5'- AGCCCTTCAGAGCCCAG -3'
(R):5'- GCCCCATCATCACTCCAGAG -3'
Posted On2021-01-18