Mutagenetix > Incidental Mutation

Incidental Mutation 'R8350:Igsf10'

660205

Institutional Source

Beutler Lab

Gene Symbol

Igsf10

Ensembl Gene

ENSMUSG00000036334

Gene Name

immunoglobulin superfamily, member 10

Synonyms

Adlican2, CMF608, 6530405F15Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001162884; MGI: 1923481

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R8350 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

59316735-59344394 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 59331528 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 411 (P411S)

Ref Sequence

ENSEMBL: ENSMUSP00000141391 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039419] [ENSMUST00000193455] [ENSMUST00000194546]

AlphaFold

Q3V1M1

Predicted Effect

probably damaging
Transcript: ENSMUST00000039419
AA Change: P411S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000037246
Gene: ENSMUSG00000036334
AA Change: P411S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000193455
AA Change: P411S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141971
Gene: ENSMUSG00000036334
AA Change: P411S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000194546
AA Change: P411S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000141391
Gene: ENSMUSG00000036334
AA Change: P411S

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	28	61	3.24e-4	SMART
LRR	57	79	9.24e1	SMART
LRR	80	103	2.02e-1	SMART
LRR	104	127	7.16e0	SMART
LRR_TYP	128	151	1.2e-3	SMART
LRR	152	175	1.25e-1	SMART
LRR	188	207	2.33e2	SMART
LRRCT	219	280	4.19e-4	SMART
IGc2	488	558	2.34e-4	SMART
IGc2	586	652	7.88e-11	SMART
low complexity region	917	930	N/A	INTRINSIC
low complexity region	1175	1185	N/A	INTRINSIC
low complexity region	1245	1263	N/A	INTRINSIC
low complexity region	1311	1321	N/A	INTRINSIC
low complexity region	1449	1465	N/A	INTRINSIC
IGc2	1632	1701	7.69e-14	SMART
IGc2	1729	1798	5.07e-14	SMART
IGc2	1826	1895	2.19e-9	SMART
IGc2	1925	1994	4.59e-12	SMART
IGc2	2022	2097	1.33e-8	SMART
IGc2	2125	2191	2.96e-15	SMART
IGc2	2223	2291	2.03e-4	SMART
IGc2	2321	2389	9.99e-13	SMART
IGc2	2416	2484	3.03e-12	SMART
IGc2	2512	2583	7.76e-10	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

100% (59/59)

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	G	T	5: 8,928,578		probably null	Het
Adam29	A	G	8: 55,872,189	V410A	possibly damaging	Het
Adamts3	T	C	5: 89,702,956	T575A	probably damaging	Het
Ankmy1	T	C	1: 92,876,631	K877E	possibly damaging	Het
Arpin	A	T	7: 79,931,867	I35N	possibly damaging	Het
BC030500	T	C	8: 58,912,354	I13T	unknown	Het
Bcas1	T	C	2: 170,406,300	N234D	possibly damaging	Het
Clca2	C	T	3: 145,077,907	G649E	probably benign	Het
Cnot2	A	T	10: 116,486,276	L516Q	probably damaging	Het
Ctdp1	C	A	18: 80,469,279	V90L	probably benign	Het
Cyb5b	A	G	8: 107,169,920	Y91C	possibly damaging	Het
Cystm1	T	C	18: 36,393,250		probably benign	Het
Dnhd1	C	A	7: 105,678,024	Q727K	probably damaging	Het
Dpf3	G	A	12: 83,350,851	R80C	probably damaging	Het
Ehmt2	C	T	17: 34,908,691	T882M	probably damaging	Het
Fam136a	A	G	6: 86,368,813	K104R	probably benign	Het
Fcgbp	T	C	7: 28,094,189	V1172A	probably benign	Het
Foxc1	C	T	13: 31,807,565	Q120*	probably null	Het
Gm5737	T	C	7: 120,820,650	L206P	probably damaging	Het
Grin1	G	A	2: 25,298,311	R448C	probably damaging	Het
Irgq	T	A	7: 24,533,740	D335E	probably benign	Het
Kndc1	A	G	7: 139,924,045	Y1088C	probably damaging	Het
Llgl1	A	G	11: 60,712,121	E874G	probably damaging	Het
Lrp8	A	G	4: 107,847,464	N168D	probably benign	Het
Lyst	T	A	13: 13,650,388	C1529*	probably null	Het
Mau2	A	T	8: 70,042,592	Y32N	probably damaging	Het
Mios	T	A	6: 8,227,998	N638K	probably benign	Het
Mki67	A	T	7: 135,698,471	D1611E	possibly damaging	Het
Mroh2a	G	A	1: 88,244,083		probably null	Het
Nek5	A	G	8: 22,113,672	V138A	probably damaging	Het
Olfr107	A	T	17: 37,406,369	M274L	probably benign	Het
Olfr29-ps1	T	A	4: 43,782,175	I52F	probably benign	Het
Olfr342	T	A	2: 36,528,164	Y251N	probably damaging	Het
Opcml	A	T	9: 28,902,167	E251D	probably benign	Het
Pde1b	A	T	15: 103,503,474	M1L	probably benign	Het
Pias1	G	A	9: 62,951,984	H72Y	probably damaging	Het
Postn	G	A	3: 54,370,258	V225I	probably damaging	Het
Prickle2	A	G	6: 92,376,502	V661A	probably benign	Het
Ptpn1	T	A	2: 167,974,241	F225Y	probably damaging	Het
Ptprd	C	T	4: 75,950,661	V1425M	probably damaging	Het
Rbfox1	C	A	16: 7,277,090	S111R	probably benign	Het
Rbm24	T	C	13: 46,419,200		probably null	Het
Rlf	T	G	4: 121,170,757	K224T	probably damaging	Het
Scgb2b3	G	A	7: 31,362,060	L5F	probably damaging	Het
Serpinb9g	A	G	13: 33,492,871	E212G	probably damaging	Het
Sh3pxd2a	T	C	19: 47,268,707	Y524C	probably damaging	Het
Sh3pxd2a	C	A	19: 47,269,838	E475D	probably null	Het
Skil	A	G	3: 31,097,454	T42A	probably benign	Het
Sorcs2	A	G	5: 36,153,863	V203A	probably damaging	Het
Sugp2	C	T	8: 70,242,991	R205*	probably null	Het
Tle1	C	A	4: 72,138,966		probably benign	Het
Tmem63c	T	A	12: 87,072,886	L318Q	probably damaging	Het
Txnrd1	A	G	10: 82,881,925	I248V	probably benign	Het
Vmn2r79	T	A	7: 87,037,533	C707*	probably null	Het
Xdh	C	T	17: 73,934,842	G154D	probably damaging	Het
Xirp2	T	A	2: 67,525,369	D3491E	probably benign	Het
Yjefn3	A	G	8: 69,889,219	L77P	probably damaging	Het
Zer1	C	T	2: 30,101,850	E653K	probably damaging	Het
Zfyve27	T	C	19: 42,179,472	V151A	probably benign	Het
Zim1	T	A	7: 6,682,065	S129C	probably damaging	Het

Other mutations in Igsf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Igsf10	APN	3	59331539	missense	probably benign	0.03
IGL00790:Igsf10	APN	3	59319517	missense	probably damaging	1.00
IGL00916:Igsf10	APN	3	59331127	missense	probably damaging	0.97
IGL00928:Igsf10	APN	3	59330597	missense	probably benign	0.00
IGL01066:Igsf10	APN	3	59327782	critical splice donor site	probably null
IGL01107:Igsf10	APN	3	59331524	missense	probably damaging	1.00
IGL01420:Igsf10	APN	3	59319650	missense	probably benign	0.02
IGL01533:Igsf10	APN	3	59319230	missense	probably damaging	0.98
IGL01537:Igsf10	APN	3	59330031	missense	probably benign	0.00
IGL01676:Igsf10	APN	3	59326011	missense	probably benign	0.06
IGL01676:Igsf10	APN	3	59329335	missense	probably benign	0.17
IGL01960:Igsf10	APN	3	59318737	missense	probably benign	0.00
IGL02123:Igsf10	APN	3	59318660	missense	probably damaging	0.97
IGL02198:Igsf10	APN	3	59325978	missense	possibly damaging	0.95
IGL02268:Igsf10	APN	3	59331152	nonsense	probably null
IGL02313:Igsf10	APN	3	59330690	missense	probably benign	0.01
IGL02368:Igsf10	APN	3	59328231	missense	probably benign
IGL02494:Igsf10	APN	3	59328006	missense	probably damaging	0.98
IGL02549:Igsf10	APN	3	59329241	missense	probably benign	0.03
IGL02616:Igsf10	APN	3	59318606	missense	probably benign	0.06
IGL02957:Igsf10	APN	3	59330864	missense	probably damaging	1.00
IGL03067:Igsf10	APN	3	59318918	missense	probably benign	0.25
IGL03104:Igsf10	APN	3	59319484	missense	probably damaging	1.00
IGL03124:Igsf10	APN	3	59319665	missense	probably benign	0.01
IGL03212:Igsf10	APN	3	59328165	missense	probably benign	0.09
IGL03347:Igsf10	APN	3	59331900	missense	possibly damaging	0.94
IGL03357:Igsf10	APN	3	59336211	missense	probably benign	0.35
F6893:Igsf10	UTSW	3	59331060	missense	probably damaging	1.00
FR4449:Igsf10	UTSW	3	59319110	missense	probably damaging	1.00
PIT1430001:Igsf10	UTSW	3	59328158	missense	probably benign	0.06
PIT4402001:Igsf10	UTSW	3	59325579	missense	probably benign	0.00
PIT4810001:Igsf10	UTSW	3	59318482	missense	probably damaging	1.00
R0068:Igsf10	UTSW	3	59330624	missense	probably damaging	0.98
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0095:Igsf10	UTSW	3	59331196	nonsense	probably null
R0112:Igsf10	UTSW	3	59326008	missense	probably benign	0.00
R0141:Igsf10	UTSW	3	59330832	missense	probably damaging	1.00
R0538:Igsf10	UTSW	3	59320106	missense	probably damaging	0.99
R0551:Igsf10	UTSW	3	59328668	missense	probably benign	0.01
R0556:Igsf10	UTSW	3	59328875	missense	probably benign	0.02
R0582:Igsf10	UTSW	3	59319767	missense	probably benign	0.00
R0630:Igsf10	UTSW	3	59326062	missense	probably damaging	1.00
R0675:Igsf10	UTSW	3	59328594	missense	probably benign	0.14
R0948:Igsf10	UTSW	3	59331104	missense	probably damaging	1.00
R1252:Igsf10	UTSW	3	59331848	missense	probably benign	0.03
R1412:Igsf10	UTSW	3	59327775	splice site	probably benign
R1473:Igsf10	UTSW	3	59318767	missense	probably damaging	1.00
R1585:Igsf10	UTSW	3	59330417	missense	probably damaging	1.00
R1650:Igsf10	UTSW	3	59326162	missense	probably damaging	1.00
R1660:Igsf10	UTSW	3	59331285	missense	probably damaging	1.00
R1671:Igsf10	UTSW	3	59328500	nonsense	probably null
R1748:Igsf10	UTSW	3	59319093	missense	probably damaging	1.00
R1758:Igsf10	UTSW	3	59329196	missense	probably benign	0.09
R1856:Igsf10	UTSW	3	59331272	missense	possibly damaging	0.63
R1912:Igsf10	UTSW	3	59329572	missense	probably benign	0.40
R2148:Igsf10	UTSW	3	59336577	missense	possibly damaging	0.77
R2155:Igsf10	UTSW	3	59331680	missense	probably damaging	1.00
R2509:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2511:Igsf10	UTSW	3	59331866	missense	probably damaging	1.00
R2680:Igsf10	UTSW	3	59325454	missense	probably benign	0.14
R2913:Igsf10	UTSW	3	59331736	missense	possibly damaging	0.70
R2927:Igsf10	UTSW	3	59329427	missense	probably benign
R3547:Igsf10	UTSW	3	59330541	missense	probably benign	0.02
R3547:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3548:Igsf10	UTSW	3	59336514	missense	probably damaging	1.00
R3620:Igsf10	UTSW	3	59336331	missense	probably damaging	1.00
R3732:Igsf10	UTSW	3	59325714	missense	probably benign	0.29
R3743:Igsf10	UTSW	3	59326125	missense	possibly damaging	0.69
R3973:Igsf10	UTSW	3	59331924	missense	probably damaging	1.00
R4005:Igsf10	UTSW	3	59328560	missense	probably benign	0.00
R4184:Igsf10	UTSW	3	59319731	missense	probably damaging	1.00
R4302:Igsf10	UTSW	3	59318750	missense	probably damaging	1.00
R4404:Igsf10	UTSW	3	59329551	missense	probably benign	0.04
R4575:Igsf10	UTSW	3	59330100	missense	probably benign
R4676:Igsf10	UTSW	3	59325949	missense	probably benign	0.23
R4700:Igsf10	UTSW	3	59320330	missense	probably damaging	0.99
R4765:Igsf10	UTSW	3	59329705	missense	probably benign	0.01
R4986:Igsf10	UTSW	3	59328606	missense	probably benign	0.24
R5012:Igsf10	UTSW	3	59318722	missense	probably damaging	1.00
R5070:Igsf10	UTSW	3	59328293	missense	probably benign	0.02
R5083:Igsf10	UTSW	3	59326273	missense	probably damaging	1.00
R5336:Igsf10	UTSW	3	59320132	missense	probably damaging	1.00
R5462:Igsf10	UTSW	3	59325754	missense	probably damaging	1.00
R5648:Igsf10	UTSW	3	59328153	missense	probably benign	0.01
R5810:Igsf10	UTSW	3	59319071	missense	probably damaging	1.00
R5871:Igsf10	UTSW	3	59330411	missense	possibly damaging	0.83
R5880:Igsf10	UTSW	3	59330831	missense	probably damaging	1.00
R5935:Igsf10	UTSW	3	59328157	missense	probably benign	0.12
R5979:Igsf10	UTSW	3	59336473	missense	probably damaging	1.00
R6145:Igsf10	UTSW	3	59331656	missense	possibly damaging	0.83
R6222:Igsf10	UTSW	3	59318915	missense	possibly damaging	0.90
R6224:Igsf10	UTSW	3	59325510	missense	probably damaging	1.00
R6264:Igsf10	UTSW	3	59328507	missense	possibly damaging	0.88
R6283:Igsf10	UTSW	3	59319449	missense	probably damaging	1.00
R6336:Igsf10	UTSW	3	59330339	missense	probably benign	0.00
R6490:Igsf10	UTSW	3	59329571	missense	probably benign	0.06
R6785:Igsf10	UTSW	3	59319244	missense	probably damaging	1.00
R6873:Igsf10	UTSW	3	59328444	missense	probably benign
R6889:Igsf10	UTSW	3	59331933	missense	probably benign
R7024:Igsf10	UTSW	3	59331701	missense	probably benign	0.00
R7056:Igsf10	UTSW	3	59331080	missense	probably damaging	1.00
R7128:Igsf10	UTSW	3	59328905	missense	probably benign
R7251:Igsf10	UTSW	3	59319454	missense	probably damaging	1.00
R7313:Igsf10	UTSW	3	59329416	missense	probably benign	0.05
R7340:Igsf10	UTSW	3	59325768	missense	probably damaging	1.00
R7447:Igsf10	UTSW	3	59331801	missense	probably benign	0.39
R7506:Igsf10	UTSW	3	59319354	missense	probably damaging	1.00
R7678:Igsf10	UTSW	3	59319340	missense	possibly damaging	0.81
R7695:Igsf10	UTSW	3	59326191	missense	probably damaging	1.00
R7709:Igsf10	UTSW	3	59331543	missense	probably damaging	0.96
R7749:Igsf10	UTSW	3	59329128	missense	possibly damaging	0.88
R7808:Igsf10	UTSW	3	59328068	missense	probably benign	0.00
R7850:Igsf10	UTSW	3	59319632	missense	probably benign	0.33
R7879:Igsf10	UTSW	3	59330724	missense	probably damaging	1.00
R7886:Igsf10	UTSW	3	59328327	missense	probably benign	0.01
R7891:Igsf10	UTSW	3	59328411	nonsense	probably null
R7946:Igsf10	UTSW	3	59319704	missense	possibly damaging	0.69
R7948:Igsf10	UTSW	3	59331858	missense	probably benign	0.02
R8004:Igsf10	UTSW	3	59329709	missense	probably benign	0.01
R8096:Igsf10	UTSW	3	59328959	missense	probably damaging	0.98
R8141:Igsf10	UTSW	3	59330528	missense	probably damaging	0.96
R8183:Igsf10	UTSW	3	59330615	missense	probably benign	0.04
R8203:Igsf10	UTSW	3	59328833	missense	probably benign	0.11
R8325:Igsf10	UTSW	3	59318533	missense	probably damaging	0.96
R8387:Igsf10	UTSW	3	59329143	missense	probably damaging	1.00
R8488:Igsf10	UTSW	3	59320010	missense	probably damaging	1.00
R8697:Igsf10	UTSW	3	59318887	missense	probably benign	0.02
R8786:Igsf10	UTSW	3	59330642	missense	probably benign	0.25
R8804:Igsf10	UTSW	3	59336455	missense	probably damaging	1.00
R8886:Igsf10	UTSW	3	59329989	missense	probably benign	0.00
R8902:Igsf10	UTSW	3	59336212	missense	probably benign	0.00
R8906:Igsf10	UTSW	3	59326318	missense	probably benign	0.01
R8917:Igsf10	UTSW	3	59319467	missense	possibly damaging	0.69
R9051:Igsf10	UTSW	3	59329247	missense	probably benign	0.00
R9178:Igsf10	UTSW	3	59326059	missense	possibly damaging	0.69
R9228:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9230:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9231:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9232:Igsf10	UTSW	3	59336422	missense	probably damaging	1.00
R9417:Igsf10	UTSW	3	59329105	missense	possibly damaging	0.94
R9609:Igsf10	UTSW	3	59319448	missense	probably damaging	1.00
R9631:Igsf10	UTSW	3	59330483	missense	probably damaging	1.00
R9689:Igsf10	UTSW	3	59326203	missense	probably damaging	1.00
R9762:Igsf10	UTSW	3	59329685	missense	probably damaging	1.00
R9770:Igsf10	UTSW	3	59319778	missense	probably benign	0.07
R9798:Igsf10	UTSW	3	59331705	missense	probably damaging	1.00
Z1088:Igsf10	UTSW	3	59329938	missense	possibly damaging	0.59
Z1177:Igsf10	UTSW	3	59329605	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTCCATTTGCGTTTCACCGG -3'
(R):5'- AGCCTTCTAGGACATTACCAATTG -3'

Sequencing Primer
(F):5'- GGTCTCATCTCTGCCTTTGGTAAAG -3'
(R):5'- GGACATTACCAATTGCATTCACTG -3'

Posted On

2021-01-18