Incidental Mutation 'R8350:Adamts3'
ID 660214
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 3
Synonyms 6330442E02Rik, 1100001H14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8350 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 89677087-89883334 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89702956 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 575 (T575A)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably damaging
Transcript: ENSMUST00000061427
AA Change: T575A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: T575A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163159
AA Change: T575A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: T575A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G T 5: 8,928,578 probably null Het
Adam29 A G 8: 55,872,189 V410A possibly damaging Het
Ankmy1 T C 1: 92,876,631 K877E possibly damaging Het
Arpin A T 7: 79,931,867 I35N possibly damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcas1 T C 2: 170,406,300 N234D possibly damaging Het
Clca2 C T 3: 145,077,907 G649E probably benign Het
Cnot2 A T 10: 116,486,276 L516Q probably damaging Het
Ctdp1 C A 18: 80,469,279 V90L probably benign Het
Cyb5b A G 8: 107,169,920 Y91C possibly damaging Het
Cystm1 T C 18: 36,393,250 probably benign Het
Dnhd1 C A 7: 105,678,024 Q727K probably damaging Het
Dpf3 G A 12: 83,350,851 R80C probably damaging Het
Ehmt2 C T 17: 34,908,691 T882M probably damaging Het
Fam136a A G 6: 86,368,813 K104R probably benign Het
Fcgbp T C 7: 28,094,189 V1172A probably benign Het
Foxc1 C T 13: 31,807,565 Q120* probably null Het
Gm5737 T C 7: 120,820,650 L206P probably damaging Het
Grin1 G A 2: 25,298,311 R448C probably damaging Het
Igsf10 G A 3: 59,331,528 P411S probably damaging Het
Irgq T A 7: 24,533,740 D335E probably benign Het
Kndc1 A G 7: 139,924,045 Y1088C probably damaging Het
Llgl1 A G 11: 60,712,121 E874G probably damaging Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Lyst T A 13: 13,650,388 C1529* probably null Het
Mau2 A T 8: 70,042,592 Y32N probably damaging Het
Mios T A 6: 8,227,998 N638K probably benign Het
Mki67 A T 7: 135,698,471 D1611E possibly damaging Het
Mroh2a G A 1: 88,244,083 probably null Het
Nek5 A G 8: 22,113,672 V138A probably damaging Het
Olfr107 A T 17: 37,406,369 M274L probably benign Het
Olfr29-ps1 T A 4: 43,782,175 I52F probably benign Het
Olfr342 T A 2: 36,528,164 Y251N probably damaging Het
Opcml A T 9: 28,902,167 E251D probably benign Het
Pde1b A T 15: 103,503,474 M1L probably benign Het
Pias1 G A 9: 62,951,984 H72Y probably damaging Het
Postn G A 3: 54,370,258 V225I probably damaging Het
Prickle2 A G 6: 92,376,502 V661A probably benign Het
Ptpn1 T A 2: 167,974,241 F225Y probably damaging Het
Ptprd C T 4: 75,950,661 V1425M probably damaging Het
Rbfox1 C A 16: 7,277,090 S111R probably benign Het
Rbm24 T C 13: 46,419,200 probably null Het
Rlf T G 4: 121,170,757 K224T probably damaging Het
Scgb2b3 G A 7: 31,362,060 L5F probably damaging Het
Serpinb9g A G 13: 33,492,871 E212G probably damaging Het
Sh3pxd2a T C 19: 47,268,707 Y524C probably damaging Het
Sh3pxd2a C A 19: 47,269,838 E475D probably null Het
Skil A G 3: 31,097,454 T42A probably benign Het
Sorcs2 A G 5: 36,153,863 V203A probably damaging Het
Sugp2 C T 8: 70,242,991 R205* probably null Het
Tle1 C A 4: 72,138,966 probably benign Het
Tmem63c T A 12: 87,072,886 L318Q probably damaging Het
Txnrd1 A G 10: 82,881,925 I248V probably benign Het
Vmn2r79 T A 7: 87,037,533 C707* probably null Het
Xdh C T 17: 73,934,842 G154D probably damaging Het
Xirp2 T A 2: 67,525,369 D3491E probably benign Het
Yjefn3 A G 8: 69,889,219 L77P probably damaging Het
Zer1 C T 2: 30,101,850 E653K probably damaging Het
Zfyve27 T C 19: 42,179,472 V151A probably benign Het
Zim1 T A 7: 6,682,065 S129C probably damaging Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 89861325 missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89701666 missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89684376 missense probably benign 0.06
IGL01420:Adamts3 APN 5 89703057 missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89702943 missense probably benign 0.14
IGL01676:Adamts3 APN 5 89677754 missense probably benign 0.00
IGL01676:Adamts3 APN 5 89881543 missense possibly damaging 0.54
IGL01678:Adamts3 APN 5 89707856 missense probably damaging 1.00
IGL01936:Adamts3 APN 5 89861423 missense probably benign 0.00
IGL01956:Adamts3 APN 5 89677911 missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89691473 splice site probably null
IGL02415:Adamts3 APN 5 89706647 splice site probably null
IGL03261:Adamts3 APN 5 89882897 utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89707404 missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89684467 missense probably benign
R0079:Adamts3 UTSW 5 89693053 missense probably benign 0.00
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0096:Adamts3 UTSW 5 89701717 nonsense probably null
R0477:Adamts3 UTSW 5 89684507 missense probably benign
R0605:Adamts3 UTSW 5 89861475 missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89696093 splice site probably benign
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1462:Adamts3 UTSW 5 89861349 missense probably benign 0.17
R1621:Adamts3 UTSW 5 89721701 missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89775421 missense probably benign 0.00
R2163:Adamts3 UTSW 5 89708718 missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89701771 missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89683175 missense probably damaging 0.97
R2921:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 89861534 missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89701733 missense probably benign 0.04
R3431:Adamts3 UTSW 5 89707453 splice site probably benign
R3432:Adamts3 UTSW 5 89707453 splice site probably benign
R3813:Adamts3 UTSW 5 89677926 missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89705264 missense probably damaging 0.99
R3905:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3906:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3907:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R3908:Adamts3 UTSW 5 89861355 missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89700487 missense probably benign 0.03
R4684:Adamts3 UTSW 5 89703007 missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89677816 missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89684323 missense probably benign 0.01
R5097:Adamts3 UTSW 5 89693050 missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89708643 missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89775377 missense probably benign
R5265:Adamts3 UTSW 5 89861552 missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89707300 splice site probably null
R5413:Adamts3 UTSW 5 89708767 missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89691473 splice site probably null
R5738:Adamts3 UTSW 5 89708668 missense probably damaging 1.00
R5979:Adamts3 UTSW 5 89861669 missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89691335 missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89721814 missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 89861609 missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 89861495 missense probably damaging 1.00
R7172:Adamts3 UTSW 5 89883001 start gained probably benign
R7263:Adamts3 UTSW 5 89677742 missense probably benign 0.03
R7401:Adamts3 UTSW 5 89707450 critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 89861397 missense probably benign 0.00
R7829:Adamts3 UTSW 5 89861490 missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89700440 missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 89861429 missense probably benign 0.10
R8021:Adamts3 UTSW 5 89683184 missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89775423 missense possibly damaging 0.89
R8468:Adamts3 UTSW 5 89694768 missense probably benign 0.19
R8827:Adamts3 UTSW 5 89691465 missense probably benign 0.03
R8864:Adamts3 UTSW 5 89707122 intron probably benign
R8906:Adamts3 UTSW 5 89677716 missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89706711 missense probably benign 0.17
R9005:Adamts3 UTSW 5 89677834 missense probably benign 0.08
R9378:Adamts3 UTSW 5 89700410 nonsense probably null
R9505:Adamts3 UTSW 5 89707892 missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89686891 missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89703042 missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89684449 missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89775351 missense not run
Z1177:Adamts3 UTSW 5 89707864 nonsense probably null
Z1177:Adamts3 UTSW 5 89775351 missense not run
Predicted Primers PCR Primer
(F):5'- TGTCACAGCTTACAGGGCAC -3'
(R):5'- GGAGAGTAAGGATTGAAGACCTTTTC -3'

Sequencing Primer
(F):5'- ACTCTCTCTGGTCAATTTCCTAATAG -3'
(R):5'- GAAGACCTTTTCATAAGTGTTTCCTG -3'
Posted On 2021-01-18