Incidental Mutation 'R8350:Adamts3'
ID 660214
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 067868-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8350 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89850815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 575 (T575A)
Ref Sequence ENSEMBL: ENSMUSP00000132219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159]
AlphaFold E9Q287
Predicted Effect probably damaging
Transcript: ENSMUST00000061427
AA Change: T575A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: T575A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163159
AA Change: T575A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: T575A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G T 5: 8,978,578 (GRCm39) probably null Het
Adam29 A G 8: 56,325,224 (GRCm39) V410A possibly damaging Het
Ankmy1 T C 1: 92,804,353 (GRCm39) K877E possibly damaging Het
Arpin A T 7: 79,581,615 (GRCm39) I35N possibly damaging Het
BC030500 T C 8: 59,365,388 (GRCm39) I13T unknown Het
Bcas1 T C 2: 170,248,220 (GRCm39) N234D possibly damaging Het
Clca3a2 C T 3: 144,783,668 (GRCm39) G649E probably benign Het
Cnot2 A T 10: 116,322,181 (GRCm39) L516Q probably damaging Het
Ctdp1 C A 18: 80,512,494 (GRCm39) V90L probably benign Het
Cyb5b A G 8: 107,896,552 (GRCm39) Y91C possibly damaging Het
Cystm1 T C 18: 36,526,303 (GRCm39) probably benign Het
Dnhd1 C A 7: 105,327,231 (GRCm39) Q727K probably damaging Het
Dpf3 G A 12: 83,397,625 (GRCm39) R80C probably damaging Het
Ehmt2 C T 17: 35,127,667 (GRCm39) T882M probably damaging Het
Fam136a A G 6: 86,345,795 (GRCm39) K104R probably benign Het
Fcgbp T C 7: 27,793,614 (GRCm39) V1172A probably benign Het
Foxc1 C T 13: 31,991,548 (GRCm39) Q120* probably null Het
Grin1 G A 2: 25,188,323 (GRCm39) R448C probably damaging Het
Igsf10 G A 3: 59,238,949 (GRCm39) P411S probably damaging Het
Irgq T A 7: 24,233,165 (GRCm39) D335E probably benign Het
Kndc1 A G 7: 139,503,960 (GRCm39) Y1088C probably damaging Het
Llgl1 A G 11: 60,602,947 (GRCm39) E874G probably damaging Het
Lrp8 A G 4: 107,704,661 (GRCm39) N168D probably benign Het
Lyst T A 13: 13,824,973 (GRCm39) C1529* probably null Het
Mau2 A T 8: 70,495,242 (GRCm39) Y32N probably damaging Het
Mios T A 6: 8,227,998 (GRCm39) N638K probably benign Het
Mki67 A T 7: 135,300,200 (GRCm39) D1611E possibly damaging Het
Mroh2a G A 1: 88,171,805 (GRCm39) probably null Het
Nek5 A G 8: 22,603,688 (GRCm39) V138A probably damaging Het
Opcml A T 9: 28,813,463 (GRCm39) E251D probably benign Het
Or13c7e-ps1 T A 4: 43,782,175 (GRCm39) I52F probably benign Het
Or1j14 T A 2: 36,418,176 (GRCm39) Y251N probably damaging Het
Or1o1 A T 17: 37,717,260 (GRCm39) M274L probably benign Het
Pde1b A T 15: 103,411,901 (GRCm39) M1L probably benign Het
Pias1 G A 9: 62,859,266 (GRCm39) H72Y probably damaging Het
Postn G A 3: 54,277,679 (GRCm39) V225I probably damaging Het
Prickle2 A G 6: 92,353,483 (GRCm39) V661A probably benign Het
Ptpn1 T A 2: 167,816,161 (GRCm39) F225Y probably damaging Het
Ptprd C T 4: 75,868,898 (GRCm39) V1425M probably damaging Het
Rbfox1 C A 16: 7,094,954 (GRCm39) S111R probably benign Het
Rbm24 T C 13: 46,572,676 (GRCm39) probably null Het
Rlf T G 4: 121,027,954 (GRCm39) K224T probably damaging Het
Scgb2b3 G A 7: 31,061,485 (GRCm39) L5F probably damaging Het
Sdr42e2 T C 7: 120,419,873 (GRCm39) L206P probably damaging Het
Serpinb9g A G 13: 33,676,854 (GRCm39) E212G probably damaging Het
Sh3pxd2a T C 19: 47,257,146 (GRCm39) Y524C probably damaging Het
Sh3pxd2a C A 19: 47,258,277 (GRCm39) E475D probably null Het
Skil A G 3: 31,151,603 (GRCm39) T42A probably benign Het
Sorcs2 A G 5: 36,311,207 (GRCm39) V203A probably damaging Het
Sugp2 C T 8: 70,695,641 (GRCm39) R205* probably null Het
Tle1 C A 4: 72,057,203 (GRCm39) probably benign Het
Tmem63c T A 12: 87,119,660 (GRCm39) L318Q probably damaging Het
Txnrd1 A G 10: 82,717,759 (GRCm39) I248V probably benign Het
Vmn2r79 T A 7: 86,686,741 (GRCm39) C707* probably null Het
Xdh C T 17: 74,241,837 (GRCm39) G154D probably damaging Het
Xirp2 T A 2: 67,355,713 (GRCm39) D3491E probably benign Het
Yjefn3 A G 8: 70,341,869 (GRCm39) L77P probably damaging Het
Zer1 C T 2: 29,991,862 (GRCm39) E653K probably damaging Het
Zfyve27 T C 19: 42,167,911 (GRCm39) V151A probably benign Het
Zim1 T A 7: 6,685,064 (GRCm39) S129C probably damaging Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R0605:Adamts3 UTSW 5 90,009,334 (GRCm39) missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89,923,280 (GRCm39) missense probably benign 0.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2923:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3431:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 90,009,468 (GRCm39) missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7829:Adamts3 UTSW 5 90,009,349 (GRCm39) missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 90,009,288 (GRCm39) missense probably benign 0.10
R8021:Adamts3 UTSW 5 89,831,043 (GRCm39) missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89,854,570 (GRCm39) missense probably benign 0.17
R9005:Adamts3 UTSW 5 89,825,693 (GRCm39) missense probably benign 0.08
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCACAGCTTACAGGGCAC -3'
(R):5'- GGAGAGTAAGGATTGAAGACCTTTTC -3'

Sequencing Primer
(F):5'- ACTCTCTCTGGTCAATTTCCTAATAG -3'
(R):5'- GAAGACCTTTTCATAAGTGTTTCCTG -3'
Posted On 2021-01-18