Incidental Mutation 'R8350:Scgb2b3'
ID660221
Institutional Source Beutler Lab
Gene Symbol Scgb2b3
Ensembl Gene ENSMUSG00000078754
Gene Namesecretoglobin, family 2B, member 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R8350 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location31359038-31362072 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31362060 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 5 (L5F)
Ref Sequence ENSEMBL: ENSMUSP00000103725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108090]
Predicted Effect probably damaging
Transcript: ENSMUST00000108090
AA Change: L5F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103725
Gene: ENSMUSG00000078754
AA Change: L5F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Feld-I_B 25 91 4.6e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G T 5: 8,928,578 probably null Het
Adam29 A G 8: 55,872,189 V410A possibly damaging Het
Adamts3 T C 5: 89,702,956 T575A probably damaging Het
Ankmy1 T C 1: 92,876,631 K877E possibly damaging Het
Arpin A T 7: 79,931,867 I35N possibly damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcas1 T C 2: 170,406,300 N234D possibly damaging Het
Clca2 C T 3: 145,077,907 G649E probably benign Het
Cnot2 A T 10: 116,486,276 L516Q probably damaging Het
Ctdp1 C A 18: 80,469,279 V90L probably benign Het
Cyb5b A G 8: 107,169,920 Y91C possibly damaging Het
Cystm1 T C 18: 36,393,250 probably benign Het
Dnhd1 C A 7: 105,678,024 Q727K probably damaging Het
Dpf3 G A 12: 83,350,851 R80C probably damaging Het
Ehmt2 C T 17: 34,908,691 T882M probably damaging Het
Fam136a A G 6: 86,368,813 K104R probably benign Het
Fcgbp T C 7: 28,094,189 V1172A probably benign Het
Foxc1 C T 13: 31,807,565 Q120* probably null Het
Gm5737 T C 7: 120,820,650 L206P probably damaging Het
Grin1 G A 2: 25,298,311 R448C probably damaging Het
Igsf10 G A 3: 59,331,528 P411S probably damaging Het
Irgq T A 7: 24,533,740 D335E probably benign Het
Kndc1 A G 7: 139,924,045 Y1088C probably damaging Het
Llgl1 A G 11: 60,712,121 E874G probably damaging Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Lyst T A 13: 13,650,388 C1529* probably null Het
Mau2 A T 8: 70,042,592 Y32N probably damaging Het
Mios T A 6: 8,227,998 N638K probably benign Het
Mki67 A T 7: 135,698,471 D1611E possibly damaging Het
Mroh2a G A 1: 88,244,083 probably null Het
Nek5 A G 8: 22,113,672 V138A probably damaging Het
Olfr107 A T 17: 37,406,369 M274L probably benign Het
Olfr29-ps1 T A 4: 43,782,175 I52F probably benign Het
Olfr342 T A 2: 36,528,164 Y251N probably damaging Het
Opcml A T 9: 28,902,167 E251D probably benign Het
Pde1b A T 15: 103,503,474 M1L probably benign Het
Pias1 G A 9: 62,951,984 H72Y probably damaging Het
Postn G A 3: 54,370,258 V225I probably damaging Het
Prickle2 A G 6: 92,376,502 V661A probably benign Het
Ptpn1 T A 2: 167,974,241 F225Y probably damaging Het
Ptprd C T 4: 75,950,661 V1425M probably damaging Het
Rbfox1 C A 16: 7,277,090 S111R probably benign Het
Rbm24 T C 13: 46,419,200 probably null Het
Rlf T G 4: 121,170,757 K224T probably damaging Het
Serpinb9g A G 13: 33,492,871 E212G probably damaging Het
Sh3pxd2a T C 19: 47,268,707 Y524C probably damaging Het
Sh3pxd2a C A 19: 47,269,838 E475D probably null Het
Skil A G 3: 31,097,454 T42A probably benign Het
Sorcs2 A G 5: 36,153,863 V203A probably damaging Het
Sugp2 C T 8: 70,242,991 R205* probably null Het
Tle1 C A 4: 72,138,966 probably benign Het
Tmem63c T A 12: 87,072,886 L318Q probably damaging Het
Txnrd1 A G 10: 82,881,925 I248V probably benign Het
Vmn2r79 T A 7: 87,037,533 C707* probably null Het
Xdh C T 17: 73,934,842 G154D probably damaging Het
Xirp2 T A 2: 67,525,369 D3491E probably benign Het
Yjefn3 A G 8: 69,889,219 L77P probably damaging Het
Zer1 C T 2: 30,101,850 E653K probably damaging Het
Zfyve27 T C 19: 42,179,472 V151A probably benign Het
Zim1 T A 7: 6,682,065 S129C probably damaging Het
Other mutations in Scgb2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1664:Scgb2b3 UTSW 7 31359039 makesense probably null
R1772:Scgb2b3 UTSW 7 31360196 missense possibly damaging 0.95
R3862:Scgb2b3 UTSW 7 31362005 critical splice donor site probably null
R5819:Scgb2b3 UTSW 7 31360214 missense possibly damaging 0.67
R6433:Scgb2b3 UTSW 7 31359067 missense probably benign 0.15
R7135:Scgb2b3 UTSW 7 31360214 missense possibly damaging 0.67
R7145:Scgb2b3 UTSW 7 31360148 missense probably benign 0.00
R7553:Scgb2b3 UTSW 7 31360248 missense possibly damaging 0.84
R7908:Scgb2b3 UTSW 7 31362014 missense probably damaging 0.98
R8172:Scgb2b3 UTSW 7 31359051 missense possibly damaging 0.78
X0027:Scgb2b3 UTSW 7 31360256 missense probably benign 0.00
Z1186:Scgb2b3 UTSW 7 31359121 missense probably benign
Z1186:Scgb2b3 UTSW 7 31360167 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCTTCAACTGAGCATCTATGG -3'
(R):5'- TCCCCTGTTCAAGTGGGAAG -3'

Sequencing Primer
(F):5'- CTTTGTAACTCAGAGCAGAAAGC -3'
(R):5'- GGGAATCCACAGATGCTAGATTC -3'
Posted On2021-01-18