Incidental Mutation 'R8350:Kndc1'
ID 660227
Institutional Source Beutler Lab
Gene Symbol Kndc1
Ensembl Gene ENSMUSG00000066129
Gene Name kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms B830014K08Rik, 2410012C07Rik, very-kind, VKIND
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8350 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 139894696-139941537 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 139924045 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1088 (Y1088C)
Ref Sequence ENSEMBL: ENSMUSP00000050586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053445]
AlphaFold Q0KK55
Predicted Effect probably damaging
Transcript: ENSMUST00000053445
AA Change: Y1088C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050586
Gene: ENSMUSG00000066129
AA Change: Y1088C

DomainStartEndE-ValueType
KIND 37 217 4.66e-65 SMART
Blast:KIND 381 454 2e-10 BLAST
KIND 456 620 1.22e-50 SMART
low complexity region 658 670 N/A INTRINSIC
low complexity region 755 771 N/A INTRINSIC
low complexity region 792 801 N/A INTRINSIC
low complexity region 949 965 N/A INTRINSIC
coiled coil region 1121 1151 N/A INTRINSIC
Pfam:RasGEF_N 1242 1341 2.2e-17 PFAM
Pfam:RasGEF 1464 1672 3.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a Ras guanine nucleotide exchange factor that appears to negatively regulate dendritic growth in the brain. Knockdown of this gene in senescent umbilical vein endothelial cells partially reversed the senescence, showing that this gene could potentially be targeted by anti-aging therapies. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and overtly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G T 5: 8,928,578 probably null Het
Adam29 A G 8: 55,872,189 V410A possibly damaging Het
Adamts3 T C 5: 89,702,956 T575A probably damaging Het
Ankmy1 T C 1: 92,876,631 K877E possibly damaging Het
Arpin A T 7: 79,931,867 I35N possibly damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcas1 T C 2: 170,406,300 N234D possibly damaging Het
Clca2 C T 3: 145,077,907 G649E probably benign Het
Cnot2 A T 10: 116,486,276 L516Q probably damaging Het
Ctdp1 C A 18: 80,469,279 V90L probably benign Het
Cyb5b A G 8: 107,169,920 Y91C possibly damaging Het
Cystm1 T C 18: 36,393,250 probably benign Het
Dnhd1 C A 7: 105,678,024 Q727K probably damaging Het
Dpf3 G A 12: 83,350,851 R80C probably damaging Het
Ehmt2 C T 17: 34,908,691 T882M probably damaging Het
Fam136a A G 6: 86,368,813 K104R probably benign Het
Fcgbp T C 7: 28,094,189 V1172A probably benign Het
Foxc1 C T 13: 31,807,565 Q120* probably null Het
Gm5737 T C 7: 120,820,650 L206P probably damaging Het
Grin1 G A 2: 25,298,311 R448C probably damaging Het
Igsf10 G A 3: 59,331,528 P411S probably damaging Het
Irgq T A 7: 24,533,740 D335E probably benign Het
Llgl1 A G 11: 60,712,121 E874G probably damaging Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Lyst T A 13: 13,650,388 C1529* probably null Het
Mau2 A T 8: 70,042,592 Y32N probably damaging Het
Mios T A 6: 8,227,998 N638K probably benign Het
Mki67 A T 7: 135,698,471 D1611E possibly damaging Het
Mroh2a G A 1: 88,244,083 probably null Het
Nek5 A G 8: 22,113,672 V138A probably damaging Het
Olfr107 A T 17: 37,406,369 M274L probably benign Het
Olfr29-ps1 T A 4: 43,782,175 I52F probably benign Het
Olfr342 T A 2: 36,528,164 Y251N probably damaging Het
Opcml A T 9: 28,902,167 E251D probably benign Het
Pde1b A T 15: 103,503,474 M1L probably benign Het
Pias1 G A 9: 62,951,984 H72Y probably damaging Het
Postn G A 3: 54,370,258 V225I probably damaging Het
Prickle2 A G 6: 92,376,502 V661A probably benign Het
Ptpn1 T A 2: 167,974,241 F225Y probably damaging Het
Ptprd C T 4: 75,950,661 V1425M probably damaging Het
Rbfox1 C A 16: 7,277,090 S111R probably benign Het
Rbm24 T C 13: 46,419,200 probably null Het
Rlf T G 4: 121,170,757 K224T probably damaging Het
Scgb2b3 G A 7: 31,362,060 L5F probably damaging Het
Serpinb9g A G 13: 33,492,871 E212G probably damaging Het
Sh3pxd2a T C 19: 47,268,707 Y524C probably damaging Het
Sh3pxd2a C A 19: 47,269,838 E475D probably null Het
Skil A G 3: 31,097,454 T42A probably benign Het
Sorcs2 A G 5: 36,153,863 V203A probably damaging Het
Sugp2 C T 8: 70,242,991 R205* probably null Het
Tle1 C A 4: 72,138,966 probably benign Het
Tmem63c T A 12: 87,072,886 L318Q probably damaging Het
Txnrd1 A G 10: 82,881,925 I248V probably benign Het
Vmn2r79 T A 7: 87,037,533 C707* probably null Het
Xdh C T 17: 73,934,842 G154D probably damaging Het
Xirp2 T A 2: 67,525,369 D3491E probably benign Het
Yjefn3 A G 8: 69,889,219 L77P probably damaging Het
Zer1 C T 2: 30,101,850 E653K probably damaging Het
Zfyve27 T C 19: 42,179,472 V151A probably benign Het
Zim1 T A 7: 6,682,065 S129C probably damaging Het
Other mutations in Kndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Kndc1 APN 7 139901988 splice site probably benign
IGL01061:Kndc1 APN 7 139922694 missense probably benign 0.00
IGL01099:Kndc1 APN 7 139920784 missense probably damaging 1.00
IGL01522:Kndc1 APN 7 139913972 splice site probably benign
IGL01767:Kndc1 APN 7 139930046 missense probably damaging 1.00
IGL01884:Kndc1 APN 7 139914194 missense probably damaging 1.00
IGL01932:Kndc1 APN 7 139923790 missense probably damaging 0.98
IGL02133:Kndc1 APN 7 139920767 missense probably benign 0.19
IGL02411:Kndc1 APN 7 139921913 critical splice donor site probably null
IGL02472:Kndc1 APN 7 139910901 missense probably benign 0.01
IGL02537:Kndc1 APN 7 139910410 missense probably benign 0.01
IGL02708:Kndc1 APN 7 139901181 missense probably damaging 1.00
IGL03115:Kndc1 APN 7 139921509 missense probably benign 0.28
IGL03160:Kndc1 APN 7 139920689 nonsense probably null
IGL03138:Kndc1 UTSW 7 139939878 missense possibly damaging 0.89
PIT4142001:Kndc1 UTSW 7 139923776 frame shift probably null
PIT4696001:Kndc1 UTSW 7 139932917 missense probably damaging 1.00
R0349:Kndc1 UTSW 7 139910304 missense probably benign 0.00
R0384:Kndc1 UTSW 7 139910599 missense possibly damaging 0.85
R0415:Kndc1 UTSW 7 139930124 missense probably damaging 1.00
R0421:Kndc1 UTSW 7 139908996 missense probably damaging 1.00
R0487:Kndc1 UTSW 7 139914023 missense probably null 0.19
R0530:Kndc1 UTSW 7 139901237 missense probably damaging 1.00
R0905:Kndc1 UTSW 7 139923735 missense possibly damaging 0.94
R1434:Kndc1 UTSW 7 139922684 missense probably damaging 1.00
R1608:Kndc1 UTSW 7 139927408 missense possibly damaging 0.80
R1644:Kndc1 UTSW 7 139930756 missense probably damaging 1.00
R1835:Kndc1 UTSW 7 139927711 missense probably damaging 0.99
R2012:Kndc1 UTSW 7 139921280 missense possibly damaging 0.90
R2102:Kndc1 UTSW 7 139930761 missense probably benign 0.02
R2103:Kndc1 UTSW 7 139921234 missense probably benign 0.01
R2128:Kndc1 UTSW 7 139930112 missense probably damaging 1.00
R2516:Kndc1 UTSW 7 139921822 missense probably damaging 1.00
R3030:Kndc1 UTSW 7 139901207 missense probably damaging 1.00
R3617:Kndc1 UTSW 7 139902060 splice site probably benign
R3747:Kndc1 UTSW 7 139927904 critical splice donor site probably null
R3848:Kndc1 UTSW 7 139908977 missense probably damaging 1.00
R4028:Kndc1 UTSW 7 139930028 missense probably damaging 0.98
R4043:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4044:Kndc1 UTSW 7 139924129 missense probably benign 0.06
R4095:Kndc1 UTSW 7 139937025 missense possibly damaging 0.49
R4289:Kndc1 UTSW 7 139910882 missense probably benign 0.01
R4478:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R4514:Kndc1 UTSW 7 139910286 missense probably benign 0.00
R4540:Kndc1 UTSW 7 139921427 nonsense probably null
R4584:Kndc1 UTSW 7 139901243 missense probably damaging 1.00
R4693:Kndc1 UTSW 7 139921779 missense probably benign 0.02
R4705:Kndc1 UTSW 7 139930123 missense possibly damaging 0.81
R4773:Kndc1 UTSW 7 139924031 nonsense probably null
R4859:Kndc1 UTSW 7 139921905 missense probably benign 0.03
R5004:Kndc1 UTSW 7 139932879 nonsense probably null
R5037:Kndc1 UTSW 7 139910455 missense possibly damaging 0.52
R5322:Kndc1 UTSW 7 139936809 missense probably damaging 1.00
R5428:Kndc1 UTSW 7 139908962 missense probably damaging 0.99
R5503:Kndc1 UTSW 7 139931889 missense probably damaging 1.00
R5506:Kndc1 UTSW 7 139927891 missense probably damaging 1.00
R5525:Kndc1 UTSW 7 139924111 missense probably benign 0.00
R5888:Kndc1 UTSW 7 139895217 missense probably benign 0.00
R5942:Kndc1 UTSW 7 139936879 missense probably damaging 1.00
R5979:Kndc1 UTSW 7 139939827 missense probably benign 0.05
R5990:Kndc1 UTSW 7 139927420 missense probably damaging 0.99
R6038:Kndc1 UTSW 7 139923775 frame shift probably null
R6076:Kndc1 UTSW 7 139902038 missense probably damaging 1.00
R6118:Kndc1 UTSW 7 139923802 missense probably damaging 1.00
R6151:Kndc1 UTSW 7 139921213 missense probably benign 0.04
R6276:Kndc1 UTSW 7 139921063 missense probably benign
R6367:Kndc1 UTSW 7 139913506 missense probably damaging 1.00
R6726:Kndc1 UTSW 7 139922751 critical splice donor site probably null
R6745:Kndc1 UTSW 7 139920976 missense probably benign 0.02
R6886:Kndc1 UTSW 7 139913569 missense probably benign 0.01
R6912:Kndc1 UTSW 7 139910278 missense probably damaging 0.99
R7070:Kndc1 UTSW 7 139921828 missense probably damaging 1.00
R7123:Kndc1 UTSW 7 139936836 missense probably damaging 0.99
R7158:Kndc1 UTSW 7 139931860 missense possibly damaging 0.48
R7248:Kndc1 UTSW 7 139920783 missense probably damaging 1.00
R7437:Kndc1 UTSW 7 139909043 missense probably damaging 1.00
R7564:Kndc1 UTSW 7 139920696 missense probably benign 0.01
R7570:Kndc1 UTSW 7 139923775 frame shift probably null
R7625:Kndc1 UTSW 7 139938017 missense possibly damaging 0.90
R7629:Kndc1 UTSW 7 139895260 missense probably damaging 1.00
R7726:Kndc1 UTSW 7 139939838 missense possibly damaging 0.67
R7840:Kndc1 UTSW 7 139923816 missense probably damaging 1.00
R7859:Kndc1 UTSW 7 139920964 missense possibly damaging 0.57
R7934:Kndc1 UTSW 7 139921486 missense probably benign 0.02
R8011:Kndc1 UTSW 7 139910620 missense possibly damaging 0.90
R8062:Kndc1 UTSW 7 139918844 missense probably benign 0.01
R8134:Kndc1 UTSW 7 139901369 splice site probably null
R8197:Kndc1 UTSW 7 139913531 missense probably damaging 1.00
R8399:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8400:Kndc1 UTSW 7 139913518 missense probably damaging 1.00
R8447:Kndc1 UTSW 7 139901205 missense probably damaging 1.00
R8534:Kndc1 UTSW 7 139923753 missense probably benign 0.27
R8735:Kndc1 UTSW 7 139910214 missense probably benign 0.00
R8816:Kndc1 UTSW 7 139937996 missense probably damaging 1.00
R8883:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8899:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R8961:Kndc1 UTSW 7 139924061 missense possibly damaging 0.95
R8961:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9002:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9010:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9065:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9066:Kndc1 UTSW 7 139927795 missense possibly damaging 0.89
R9223:Kndc1 UTSW 7 139921441 missense possibly damaging 0.89
R9230:Kndc1 UTSW 7 139920684 missense probably damaging 1.00
R9291:Kndc1 UTSW 7 139895224 missense possibly damaging 0.55
R9441:Kndc1 UTSW 7 139921476 missense probably damaging 0.99
R9476:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9510:Kndc1 UTSW 7 139930118 missense probably benign 0.00
R9518:Kndc1 UTSW 7 139939914 missense probably damaging 1.00
R9758:Kndc1 UTSW 7 139920704 missense possibly damaging 0.71
Z1177:Kndc1 UTSW 7 139921912 missense possibly damaging 0.63
Z1186:Kndc1 UTSW 7 139910813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCTCTCAGGGAAACTTTGAGG -3'
(R):5'- ATCATTGCTCAGGGTGTTCC -3'

Sequencing Primer
(F):5'- CGGTCTCAGAAGTCAATAAAAGTC -3'
(R):5'- CTCAGGGTGTTCCTAAGACTACAG -3'
Posted On 2021-01-18