Incidental Mutation 'R8350:Nek5'
ID660228
Institutional Source Beutler Lab
Gene Symbol Nek5
Ensembl Gene ENSMUSG00000037738
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 5
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_177898.4; Ensembl: ENSMUST00000081815, ENSMUST00000169834

Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R8350 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22073616-22125053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22113672 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 138 (V138A)
Ref Sequence ENSEMBL: ENSMUSP00000148211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169834] [ENSMUST00000209656]
Predicted Effect probably damaging
Transcript: ENSMUST00000169834
AA Change: V138A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738
AA Change: V138A

DomainStartEndE-ValueType
S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000209656
AA Change: V138A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G T 5: 8,928,578 probably null Het
Adam29 A G 8: 55,872,189 V410A possibly damaging Het
Adamts3 T C 5: 89,702,956 T575A probably damaging Het
Ankmy1 T C 1: 92,876,631 K877E possibly damaging Het
Arpin A T 7: 79,931,867 I35N possibly damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcas1 T C 2: 170,406,300 N234D possibly damaging Het
Clca2 C T 3: 145,077,907 G649E probably benign Het
Cnot2 A T 10: 116,486,276 L516Q probably damaging Het
Ctdp1 C A 18: 80,469,279 V90L probably benign Het
Cyb5b A G 8: 107,169,920 Y91C possibly damaging Het
Cystm1 T C 18: 36,393,250 probably benign Het
Dnhd1 C A 7: 105,678,024 Q727K probably damaging Het
Dpf3 G A 12: 83,350,851 R80C probably damaging Het
Ehmt2 C T 17: 34,908,691 T882M probably damaging Het
Fam136a A G 6: 86,368,813 K104R probably benign Het
Fcgbp T C 7: 28,094,189 V1172A probably benign Het
Foxc1 C T 13: 31,807,565 Q120* probably null Het
Gm5737 T C 7: 120,820,650 L206P probably damaging Het
Grin1 G A 2: 25,298,311 R448C probably damaging Het
Igsf10 G A 3: 59,331,528 P411S probably damaging Het
Irgq T A 7: 24,533,740 D335E probably benign Het
Kndc1 A G 7: 139,924,045 Y1088C probably damaging Het
Llgl1 A G 11: 60,712,121 E874G probably damaging Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Lyst T A 13: 13,650,388 C1529* probably null Het
Mau2 A T 8: 70,042,592 Y32N probably damaging Het
Mios T A 6: 8,227,998 N638K probably benign Het
Mki67 A T 7: 135,698,471 D1611E possibly damaging Het
Mroh2a G A 1: 88,244,083 probably null Het
Olfr107 A T 17: 37,406,369 M274L probably benign Het
Olfr29-ps1 T A 4: 43,782,175 I52F probably benign Het
Olfr342 T A 2: 36,528,164 Y251N probably damaging Het
Opcml A T 9: 28,902,167 E251D probably benign Het
Pde1b A T 15: 103,503,474 M1L probably benign Het
Pias1 G A 9: 62,951,984 H72Y probably damaging Het
Postn G A 3: 54,370,258 V225I probably damaging Het
Prickle2 A G 6: 92,376,502 V661A probably benign Het
Ptpn1 T A 2: 167,974,241 F225Y probably damaging Het
Ptprd C T 4: 75,950,661 V1425M probably damaging Het
Rbfox1 C A 16: 7,277,090 S111R probably benign Het
Rbm24 T C 13: 46,419,200 probably null Het
Rlf T G 4: 121,170,757 K224T probably damaging Het
Scgb2b3 G A 7: 31,362,060 L5F probably damaging Het
Serpinb9g A G 13: 33,492,871 E212G probably damaging Het
Sh3pxd2a T C 19: 47,268,707 Y524C probably damaging Het
Sh3pxd2a C A 19: 47,269,838 E475D probably null Het
Skil A G 3: 31,097,454 T42A probably benign Het
Sorcs2 A G 5: 36,153,863 V203A probably damaging Het
Sugp2 C T 8: 70,242,991 R205* probably null Het
Tle1 C A 4: 72,138,966 probably benign Het
Tmem63c T A 12: 87,072,886 L318Q probably damaging Het
Txnrd1 A G 10: 82,881,925 I248V probably benign Het
Vmn2r79 T A 7: 87,037,533 C707* probably null Het
Xdh C T 17: 73,934,842 G154D probably damaging Het
Xirp2 T A 2: 67,525,369 D3491E probably benign Het
Yjefn3 A G 8: 69,889,219 L77P probably damaging Het
Zer1 C T 2: 30,101,850 E653K probably damaging Het
Zfyve27 T C 19: 42,179,472 V151A probably benign Het
Zim1 T A 7: 6,682,065 S129C probably damaging Het
Other mutations in Nek5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Nek5 APN 8 22111183 missense possibly damaging 0.75
IGL01418:Nek5 APN 8 22095269 missense probably damaging 1.00
IGL01485:Nek5 APN 8 22083369 missense probably benign 0.05
IGL01640:Nek5 APN 8 22120840 missense probably benign 0.00
IGL01894:Nek5 APN 8 22113819 missense probably damaging 1.00
IGL01958:Nek5 APN 8 22096826 missense probably benign 0.09
IGL02332:Nek5 APN 8 22095261 missense probably benign 0.14
IGL02718:Nek5 APN 8 22097463 missense probably benign 0.15
IGL03203:Nek5 APN 8 22118768 missense probably damaging 1.00
IGL03325:Nek5 APN 8 22079142 missense probably benign
R0257:Nek5 UTSW 8 22123672 intron probably benign
R0522:Nek5 UTSW 8 22088797 splice site probably benign
R0525:Nek5 UTSW 8 22079077 unclassified probably benign
R1476:Nek5 UTSW 8 22096731 missense possibly damaging 0.86
R1483:Nek5 UTSW 8 22096790 missense probably benign 0.30
R1764:Nek5 UTSW 8 22109912 missense probably damaging 0.98
R1892:Nek5 UTSW 8 22107729 missense probably benign 0.11
R1989:Nek5 UTSW 8 22111169 missense probably damaging 1.00
R2229:Nek5 UTSW 8 22113632 missense possibly damaging 0.76
R4114:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4116:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4709:Nek5 UTSW 8 22083427 missense probably damaging 0.99
R4952:Nek5 UTSW 8 22079088 missense probably benign 0.00
R4952:Nek5 UTSW 8 22096799 missense probably benign 0.00
R5185:Nek5 UTSW 8 22083381 missense possibly damaging 0.78
R5816:Nek5 UTSW 8 22096736 missense probably benign 0.02
R5884:Nek5 UTSW 8 22088801 critical splice donor site probably null
R6009:Nek5 UTSW 8 22120822 missense probably benign 0.00
R6279:Nek5 UTSW 8 22107721 missense probably benign
R6300:Nek5 UTSW 8 22107721 missense probably benign
R6437:Nek5 UTSW 8 22085460 missense possibly damaging 0.95
R7034:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7036:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7278:Nek5 UTSW 8 22090484 missense probably benign 0.13
R7436:Nek5 UTSW 8 22108040 missense probably damaging 1.00
R7666:Nek5 UTSW 8 22090517 missense probably benign 0.12
R7827:Nek5 UTSW 8 22083387 missense possibly damaging 0.91
R8057:Nek5 UTSW 8 22088906 missense probably benign 0.21
R8847:Nek5 UTSW 8 22123579 missense probably benign 0.01
X0012:Nek5 UTSW 8 22095248 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCTCCAGAATTTTAACTGCAGAC -3'
(R):5'- GCGGACTGTTCAATAGATTCCTTCTG -3'

Sequencing Primer
(F):5'- CTGCAGACAGTCAAATGATTTAATGC -3'
(R):5'- CCGTCTGCAGATCCTGTG -3'
Posted On2021-01-18