Incidental Mutation 'R8350:Sugp2'
ID660233
Institutional Source Beutler Lab
Gene Symbol Sugp2
Ensembl Gene ENSMUSG00000036054
Gene NameSURP and G patch domain containing 2
SynonymsSrsf14, Sfrs14
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R8350 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70234226-70279915 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 70242991 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 205 (R205*)
Ref Sequence ENSEMBL: ENSMUSP00000128029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093458] [ENSMUST00000131489] [ENSMUST00000145078] [ENSMUST00000155771] [ENSMUST00000164403]
Predicted Effect probably null
Transcript: ENSMUST00000093458
AA Change: R205*
SMART Domains Protein: ENSMUSP00000091167
Gene: ENSMUSG00000036054
AA Change: R205*

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131489
AA Change: R205*
SMART Domains Protein: ENSMUSP00000114833
Gene: ENSMUSG00000036054
AA Change: R205*

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145078
SMART Domains Protein: ENSMUSP00000114403
Gene: ENSMUSG00000036054

DomainStartEndE-ValueType
low complexity region 46 57 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155771
Predicted Effect probably null
Transcript: ENSMUST00000164403
AA Change: R205*
SMART Domains Protein: ENSMUSP00000128029
Gene: ENSMUSG00000036054
AA Change: R205*

DomainStartEndE-ValueType
SWAP 570 622 3.74e-2 SMART
SWAP 768 822 1.12e-14 SMART
low complexity region 859 888 N/A INTRINSIC
G_patch 994 1040 1.13e-16 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the arginine/serine-rich family of splicing factors. The encoded protein functions in mRNA processing. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 G T 5: 8,928,578 probably null Het
Adam29 A G 8: 55,872,189 V410A possibly damaging Het
Adamts3 T C 5: 89,702,956 T575A probably damaging Het
Ankmy1 T C 1: 92,876,631 K877E possibly damaging Het
Arpin A T 7: 79,931,867 I35N possibly damaging Het
BC030500 T C 8: 58,912,354 I13T unknown Het
Bcas1 T C 2: 170,406,300 N234D possibly damaging Het
Clca2 C T 3: 145,077,907 G649E probably benign Het
Cnot2 A T 10: 116,486,276 L516Q probably damaging Het
Ctdp1 C A 18: 80,469,279 V90L probably benign Het
Cyb5b A G 8: 107,169,920 Y91C possibly damaging Het
Cystm1 T C 18: 36,393,250 probably benign Het
Dnhd1 C A 7: 105,678,024 Q727K probably damaging Het
Dpf3 G A 12: 83,350,851 R80C probably damaging Het
Ehmt2 C T 17: 34,908,691 T882M probably damaging Het
Fam136a A G 6: 86,368,813 K104R probably benign Het
Fcgbp T C 7: 28,094,189 V1172A probably benign Het
Foxc1 C T 13: 31,807,565 Q120* probably null Het
Gm5737 T C 7: 120,820,650 L206P probably damaging Het
Grin1 G A 2: 25,298,311 R448C probably damaging Het
Igsf10 G A 3: 59,331,528 P411S probably damaging Het
Irgq T A 7: 24,533,740 D335E probably benign Het
Kndc1 A G 7: 139,924,045 Y1088C probably damaging Het
Llgl1 A G 11: 60,712,121 E874G probably damaging Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Lyst T A 13: 13,650,388 C1529* probably null Het
Mau2 A T 8: 70,042,592 Y32N probably damaging Het
Mios T A 6: 8,227,998 N638K probably benign Het
Mki67 A T 7: 135,698,471 D1611E possibly damaging Het
Mroh2a G A 1: 88,244,083 probably null Het
Nek5 A G 8: 22,113,672 V138A probably damaging Het
Olfr107 A T 17: 37,406,369 M274L probably benign Het
Olfr29-ps1 T A 4: 43,782,175 I52F probably benign Het
Olfr342 T A 2: 36,528,164 Y251N probably damaging Het
Opcml A T 9: 28,902,167 E251D probably benign Het
Pde1b A T 15: 103,503,474 M1L probably benign Het
Pias1 G A 9: 62,951,984 H72Y probably damaging Het
Postn G A 3: 54,370,258 V225I probably damaging Het
Prickle2 A G 6: 92,376,502 V661A probably benign Het
Ptpn1 T A 2: 167,974,241 F225Y probably damaging Het
Ptprd C T 4: 75,950,661 V1425M probably damaging Het
Rbfox1 C A 16: 7,277,090 S111R probably benign Het
Rbm24 T C 13: 46,419,200 probably null Het
Rlf T G 4: 121,170,757 K224T probably damaging Het
Scgb2b3 G A 7: 31,362,060 L5F probably damaging Het
Serpinb9g A G 13: 33,492,871 E212G probably damaging Het
Sh3pxd2a T C 19: 47,268,707 Y524C probably damaging Het
Sh3pxd2a C A 19: 47,269,838 E475D probably null Het
Skil A G 3: 31,097,454 T42A probably benign Het
Sorcs2 A G 5: 36,153,863 V203A probably damaging Het
Tle1 C A 4: 72,138,966 probably benign Het
Tmem63c T A 12: 87,072,886 L318Q probably damaging Het
Txnrd1 A G 10: 82,881,925 I248V probably benign Het
Vmn2r79 T A 7: 87,037,533 C707* probably null Het
Xdh C T 17: 73,934,842 G154D probably damaging Het
Xirp2 T A 2: 67,525,369 D3491E probably benign Het
Yjefn3 A G 8: 69,889,219 L77P probably damaging Het
Zer1 C T 2: 30,101,850 E653K probably damaging Het
Zfyve27 T C 19: 42,179,472 V151A probably benign Het
Zim1 T A 7: 6,682,065 S129C probably damaging Het
Other mutations in Sugp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Sugp2 APN 8 70242535 missense probably damaging 1.00
IGL01126:Sugp2 APN 8 70251874 missense probably damaging 1.00
IGL01154:Sugp2 APN 8 70242699 missense probably damaging 1.00
IGL02037:Sugp2 APN 8 70259674 splice site probably benign
IGL02401:Sugp2 APN 8 70243171 missense possibly damaging 0.75
IGL02738:Sugp2 APN 8 70243799 missense probably damaging 1.00
IGL03060:Sugp2 APN 8 70243187 missense possibly damaging 0.89
PIT4687001:Sugp2 UTSW 8 70257512 missense probably damaging 0.96
PIT4791001:Sugp2 UTSW 8 70260545 nonsense probably null
R0538:Sugp2 UTSW 8 70258948 missense probably damaging 1.00
R1459:Sugp2 UTSW 8 70244064 splice site probably benign
R1687:Sugp2 UTSW 8 70242634 missense probably damaging 1.00
R1801:Sugp2 UTSW 8 70236710 missense possibly damaging 0.86
R1914:Sugp2 UTSW 8 70253660 missense probably damaging 0.98
R1915:Sugp2 UTSW 8 70253660 missense probably damaging 0.98
R2004:Sugp2 UTSW 8 70242656 splice site probably null
R2012:Sugp2 UTSW 8 70243211 missense possibly damaging 0.78
R4584:Sugp2 UTSW 8 70251898 missense probably benign 0.13
R4791:Sugp2 UTSW 8 70242790 missense probably damaging 1.00
R4970:Sugp2 UTSW 8 70259812 missense possibly damaging 0.94
R5101:Sugp2 UTSW 8 70260489 missense probably damaging 1.00
R5240:Sugp2 UTSW 8 70243275 missense probably benign 0.00
R5279:Sugp2 UTSW 8 70257107 intron probably benign
R5303:Sugp2 UTSW 8 70242177 intron probably benign
R5966:Sugp2 UTSW 8 70252103 critical splice donor site probably null
R5988:Sugp2 UTSW 8 70243225 missense probably benign
R6615:Sugp2 UTSW 8 70242770 missense possibly damaging 0.92
R7382:Sugp2 UTSW 8 70242844 missense probably benign 0.02
R7803:Sugp2 UTSW 8 70252072 missense probably benign
R7908:Sugp2 UTSW 8 70251927 missense probably benign 0.08
R8013:Sugp2 UTSW 8 70251642 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGACTTGGGCCACTCAGTTTC -3'
(R):5'- GGACTTGTCCCAATGGTCAC -3'

Sequencing Primer
(F):5'- GGGCCACTCAGTTTCTCAAGAATC -3'
(R):5'- CCAATGGTCACATCAGGACTTGG -3'
Posted On2021-01-18