Incidental Mutation 'R8355:Ap3b2'
ID660274
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Nameadaptor-related protein complex 3, beta 2 subunit
Synonymsbeta3B, Naptb
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8355 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location81460399-81493925 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81473103 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 462 (V462E)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
Predicted Effect probably damaging
Transcript: ENSMUST00000082090
AA Change: V462E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: V462E

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152355
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T A 17: 28,903,275 Q414L probably damaging Het
AA792892 T C 5: 94,383,913 C219R probably damaging Het
Abcc9 A T 6: 142,692,752 H145Q probably benign Het
Acsf2 A T 11: 94,570,624 M293K probably benign Het
Ak9 G A 10: 41,399,704 R1112Q Het
Ano8 T C 8: 71,480,566 probably benign Het
Arid1a T C 4: 133,720,863 Q498R unknown Het
AW011738 C A 4: 156,203,380 probably benign Het
Bhlhe41 T A 6: 145,865,302 probably null Het
Bnc1 A C 7: 81,968,876 S814A probably damaging Het
Cage1 A T 13: 38,019,249 L613H probably damaging Het
Camk1g T C 1: 193,351,047 I231V probably damaging Het
Catspere2 T C 1: 178,017,710 Y99H possibly damaging Het
Ccdc50 A G 16: 27,417,351 Y145C probably benign Het
Cdcp1 A G 9: 123,173,823 S728P probably benign Het
Chrm3 A T 13: 9,878,610 M130K probably damaging Het
Csf1r T C 18: 61,128,150 F766S probably damaging Het
Dact3 A G 7: 16,883,200 D108G probably damaging Het
Dnaaf5 ACCCAGCACCTGGAGATCGTCC ACC 5: 139,161,859 probably null Het
Dnah8 A C 17: 30,695,178 L1099F possibly damaging Het
Ggnbp2 C T 11: 84,837,989 probably null Het
Gk5 T C 9: 96,150,786 V274A possibly damaging Het
Gm14124 T A 2: 150,267,956 C189S unknown Het
Gnpat T C 8: 124,870,840 F47S probably benign Het
Gsap G T 5: 21,251,019 G374* probably null Het
Gtf2h2 A T 13: 100,468,995 F368Y possibly damaging Het
Gvin1 A T 7: 106,158,105 W2386R possibly damaging Het
Ighe A T 12: 113,271,547 L331* probably null Het
Itch T A 2: 155,210,582 probably null Het
K230010J24Rik C A 15: 76,034,224 Q87K probably benign Het
Lars2 G A 9: 123,454,715 A683T probably damaging Het
Lin7a C T 10: 107,382,636 R14C probably damaging Het
Lrp2 C T 2: 69,516,484 S806N probably damaging Het
Lrrc8e T A 8: 4,234,018 M81K probably benign Het
Mcm3ap C A 10: 76,493,501 T1172K probably benign Het
Mrm3 A T 11: 76,250,338 M391L possibly damaging Het
Myo9a T C 9: 59,909,847 S2278P probably damaging Het
Ncln T C 10: 81,487,869 K511E probably damaging Het
Olfr1390 G T 11: 49,340,765 V78L possibly damaging Het
Olfr888 A G 9: 38,108,962 K87R probably benign Het
Pcdhb10 G T 18: 37,412,081 G70V probably damaging Het
Phf24 A G 4: 42,933,735 E39G probably benign Het
Plat C A 8: 22,771,742 S52* probably null Het
Ptpru C A 4: 131,808,500 G389C probably damaging Het
Rnpep T C 1: 135,267,267 D407G probably damaging Het
Rttn G A 18: 89,028,892 V893I probably benign Het
Slit1 A G 19: 41,646,034 L428P probably damaging Het
Tet1 T A 10: 62,816,450 L1596F possibly damaging Het
Thsd7b T C 1: 129,595,879 C140R probably damaging Het
Usp17le A T 7: 104,769,545 M130K possibly damaging Het
Vmn2r92 T G 17: 18,184,799 I735S probably damaging Het
Zbtb42 A T 12: 112,679,535 Y48F probably damaging Het
Zbtb43 C T 2: 33,455,108 G35D possibly damaging Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81471949 missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81476939 splice site probably benign
IGL01876:Ap3b2 APN 7 81473854 splice site probably null
IGL02132:Ap3b2 APN 7 81460998 missense unknown
IGL02227:Ap3b2 APN 7 81473404 missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81465698 missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81466193 missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81473080 missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81463681 splice site probably null
R0568:Ap3b2 UTSW 7 81464629 critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81463911 missense unknown
R1121:Ap3b2 UTSW 7 81464195 missense unknown
R1160:Ap3b2 UTSW 7 81466169 critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81463690 nonsense probably null
R1542:Ap3b2 UTSW 7 81478077 splice site probably null
R1652:Ap3b2 UTSW 7 81473399 missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81467599 missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81464150 missense unknown
R2065:Ap3b2 UTSW 7 81463774 missense unknown
R2353:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2354:Ap3b2 UTSW 7 81473850 unclassified probably benign
R2398:Ap3b2 UTSW 7 81477195 missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3710:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3932:Ap3b2 UTSW 7 81473850 unclassified probably benign
R3933:Ap3b2 UTSW 7 81473850 unclassified probably benign
R4152:Ap3b2 UTSW 7 81478017 missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81477136 missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81471932 missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81477930 missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81476769 missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81476752 missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81493592 missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81473462 nonsense probably null
R6901:Ap3b2 UTSW 7 81484912 critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81477993 missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81461009 missense unknown
R7317:Ap3b2 UTSW 7 81461028 missense unknown
R7501:Ap3b2 UTSW 7 81473446 missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81466146 splice site probably null
R7643:Ap3b2 UTSW 7 81477072 missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81476782 missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81463782 missense unknown
R8273:Ap3b2 UTSW 7 81463242 missense unknown
R8325:Ap3b2 UTSW 7 81484489 splice site probably null
R8697:Ap3b2 UTSW 7 81473035 missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81477153 missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81477183 missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81467444 missense probably benign 0.02
X0013:Ap3b2 UTSW 7 81463240 critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81463764 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGGTTCTTAAAGTCATGGGG -3'
(R):5'- CCCCTTGTGTATCTAGGTAGAATG -3'

Sequencing Primer
(F):5'- CAGATCTCTGTGAGTTCAAGTCCAG -3'
(R):5'- AGAATGTGTGTCTGTTGGCTATC -3'
Posted On2021-01-18