Mutagenetix > Incidental Mutation

Incidental Mutation 'R8355:Ap3b2'

660274

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.126) question?

Stock #

R8355 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 81473103 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 462 (V462E)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

AlphaFold

Q9JME5

Predicted Effect

probably damaging
Transcript: ENSMUST00000082090
AA Change: V462E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: V462E

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000152355

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

98% (48/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930539E08Rik	T	A	17: 28,903,275	Q414L	probably damaging	Het
AA792892	T	C	5: 94,383,913	C219R	probably damaging	Het
Abcc9	A	T	6: 142,692,752	H145Q	probably benign	Het
Acsf2	A	T	11: 94,570,624	M293K	probably benign	Het
Ak9	G	A	10: 41,399,704	R1112Q		Het
Ano8	T	C	8: 71,480,566		probably benign	Het
Arid1a	T	C	4: 133,720,863	Q498R	unknown	Het
AW011738	C	A	4: 156,203,380		probably benign	Het
Bhlhe41	T	A	6: 145,865,302		probably null	Het
Bnc1	A	C	7: 81,968,876	S814A	probably damaging	Het
Cage1	A	T	13: 38,019,249	L613H	probably damaging	Het
Camk1g	T	C	1: 193,351,047	I231V	probably damaging	Het
Catspere2	T	C	1: 178,017,710	Y99H	possibly damaging	Het
Ccdc50	A	G	16: 27,417,351	Y145C	probably benign	Het
Cdcp1	A	G	9: 123,173,823	S728P	probably benign	Het
Chrm3	A	T	13: 9,878,610	M130K	probably damaging	Het
Csf1r	T	C	18: 61,128,150	F766S	probably damaging	Het
Dact3	A	G	7: 16,883,200	D108G	probably damaging	Het
Dnaaf5	ACCCAGCACCTGGAGATCGTCC	ACC	5: 139,161,859		probably null	Het
Dnah8	A	C	17: 30,695,178	L1099F	possibly damaging	Het
Ggnbp2	C	T	11: 84,837,989		probably null	Het
Gk5	T	C	9: 96,150,786	V274A	possibly damaging	Het
Gm14124	T	A	2: 150,267,956	C189S	unknown	Het
Gnpat	T	C	8: 124,870,840	F47S	probably benign	Het
Gsap	G	T	5: 21,251,019	G374*	probably null	Het
Gtf2h2	A	T	13: 100,468,995	F368Y	possibly damaging	Het
Gvin1	A	T	7: 106,158,105	W2386R	possibly damaging	Het
Ighe	A	T	12: 113,271,547	L331*	probably null	Het
Itch	T	A	2: 155,210,582		probably null	Het
K230010J24Rik	C	A	15: 76,034,224	Q87K	probably benign	Het
Lars2	G	A	9: 123,454,715	A683T	probably damaging	Het
Lin7a	C	T	10: 107,382,636	R14C	probably damaging	Het
Lrp2	C	T	2: 69,516,484	S806N	probably damaging	Het
Lrrc8e	T	A	8: 4,234,018	M81K	probably benign	Het
Mcm3ap	C	A	10: 76,493,501	T1172K	probably benign	Het
Mrm3	A	T	11: 76,250,338	M391L	possibly damaging	Het
Myo9a	T	C	9: 59,909,847	S2278P	probably damaging	Het
Ncln	T	C	10: 81,487,869	K511E	probably damaging	Het
Olfr1390	G	T	11: 49,340,765	V78L	possibly damaging	Het
Olfr888	A	G	9: 38,108,962	K87R	probably benign	Het
Pcdhb10	G	T	18: 37,412,081	G70V	probably damaging	Het
Phf24	A	G	4: 42,933,735	E39G	probably benign	Het
Plat	C	A	8: 22,771,742	S52*	probably null	Het
Ptpru	C	A	4: 131,808,500	G389C	probably damaging	Het
Rnpep	T	C	1: 135,267,267	D407G	probably damaging	Het
Rttn	G	A	18: 89,028,892	V893I	probably benign	Het
Slit1	A	G	19: 41,646,034	L428P	probably damaging	Het
Tet1	T	A	10: 62,816,450	L1596F	possibly damaging	Het
Thsd7b	T	C	1: 129,595,879	C140R	probably damaging	Het
Usp17le	A	T	7: 104,769,545	M130K	possibly damaging	Het
Vmn2r92	T	G	17: 18,184,799	I735S	probably damaging	Het
Zbtb42	A	T	12: 112,679,535	Y48F	probably damaging	Het
Zbtb43	C	T	2: 33,455,108	G35D	possibly damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1652:Ap3b2	UTSW	7	81473399	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81478009	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGGTTCTTAAAGTCATGGGG -3'
(R):5'- CCCCTTGTGTATCTAGGTAGAATG -3'

Sequencing Primer
(F):5'- CAGATCTCTGTGAGTTCAAGTCCAG -3'
(R):5'- AGAATGTGTGTCTGTTGGCTATC -3'

Posted On

2021-01-18