Incidental Mutation 'R8355:Ap3b2'
ID 660274
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
MMRRC Submission 067869-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R8355 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 81122851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 462 (V462E)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
AlphaFold Q9JME5
Predicted Effect probably damaging
Transcript: ENSMUST00000082090
AA Change: V462E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: V462E

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152355
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A T 6: 142,638,478 (GRCm39) H145Q probably benign Het
Acsf2 A T 11: 94,461,450 (GRCm39) M293K probably benign Het
Ak9 G A 10: 41,275,700 (GRCm39) R1112Q Het
Ano8 T C 8: 71,933,210 (GRCm39) probably benign Het
Arid1a T C 4: 133,448,174 (GRCm39) Q498R unknown Het
AW011738 C A 4: 156,287,837 (GRCm39) probably benign Het
Bhlhe41 T A 6: 145,811,028 (GRCm39) probably null Het
Bnc1 A C 7: 81,618,624 (GRCm39) S814A probably damaging Het
Bnip5 T A 17: 29,122,249 (GRCm39) Q414L probably damaging Het
Cage1 A T 13: 38,203,225 (GRCm39) L613H probably damaging Het
Camk1g T C 1: 193,033,355 (GRCm39) I231V probably damaging Het
Catspere2 T C 1: 177,845,276 (GRCm39) Y99H possibly damaging Het
Ccdc50 A G 16: 27,236,101 (GRCm39) Y145C probably benign Het
Cdcp1 A G 9: 123,002,888 (GRCm39) S728P probably benign Het
Chrm3 A T 13: 9,928,646 (GRCm39) M130K probably damaging Het
Csf1r T C 18: 61,261,222 (GRCm39) F766S probably damaging Het
Dact3 A G 7: 16,617,125 (GRCm39) D108G probably damaging Het
Dnaaf5 ACCCAGCACCTGGAGATCGTCC ACC 5: 139,147,614 (GRCm39) probably null Het
Dnah8 A C 17: 30,914,152 (GRCm39) L1099F possibly damaging Het
Ggnbp2 C T 11: 84,728,815 (GRCm39) probably null Het
Gk5 T C 9: 96,032,839 (GRCm39) V274A possibly damaging Het
Gnpat T C 8: 125,597,579 (GRCm39) F47S probably benign Het
Gsap G T 5: 21,456,017 (GRCm39) G374* probably null Het
Gtf2h2 A T 13: 100,605,503 (GRCm39) F368Y possibly damaging Het
Gvin1 A T 7: 105,757,312 (GRCm39) W2386R possibly damaging Het
Ighe A T 12: 113,235,167 (GRCm39) L331* probably null Het
Iqank1 C A 15: 75,906,073 (GRCm39) Q87K probably benign Het
Itch T A 2: 155,052,502 (GRCm39) probably null Het
Lars2 G A 9: 123,283,780 (GRCm39) A683T probably damaging Het
Lin7a C T 10: 107,218,497 (GRCm39) R14C probably damaging Het
Lrp2 C T 2: 69,346,828 (GRCm39) S806N probably damaging Het
Lrrc8e T A 8: 4,284,018 (GRCm39) M81K probably benign Het
Mcm3ap C A 10: 76,329,335 (GRCm39) T1172K probably benign Het
Mrm3 A T 11: 76,141,164 (GRCm39) M391L possibly damaging Het
Myo9a T C 9: 59,817,130 (GRCm39) S2278P probably damaging Het
Ncln T C 10: 81,323,703 (GRCm39) K511E probably damaging Het
Or2y17 G T 11: 49,231,592 (GRCm39) V78L possibly damaging Het
Or8b101 A G 9: 38,020,258 (GRCm39) K87R probably benign Het
Pcdhb10 G T 18: 37,545,134 (GRCm39) G70V probably damaging Het
Phf24 A G 4: 42,933,735 (GRCm39) E39G probably benign Het
Plat C A 8: 23,261,758 (GRCm39) S52* probably null Het
Pramel52-ps T C 5: 94,531,772 (GRCm39) C219R probably damaging Het
Ptpru C A 4: 131,535,811 (GRCm39) G389C probably damaging Het
Rnpep T C 1: 135,195,005 (GRCm39) D407G probably damaging Het
Rttn G A 18: 89,047,016 (GRCm39) V893I probably benign Het
Slit1 A G 19: 41,634,473 (GRCm39) L428P probably damaging Het
Tet1 T A 10: 62,652,229 (GRCm39) L1596F possibly damaging Het
Thsd7b T C 1: 129,523,616 (GRCm39) C140R probably damaging Het
Usp17le A T 7: 104,418,752 (GRCm39) M130K possibly damaging Het
Vmn2r92 T G 17: 18,405,061 (GRCm39) I735S probably damaging Het
Zbtb42 A T 12: 112,645,969 (GRCm39) Y48F probably damaging Het
Zbtb43 C T 2: 33,345,120 (GRCm39) G35D possibly damaging Het
Zfp1005 T A 2: 150,109,876 (GRCm39) C189S unknown Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1652:Ap3b2 UTSW 7 81,123,147 (GRCm39) missense probably damaging 1.00
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81,113,898 (GRCm39) missense unknown
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81,126,517 (GRCm39) missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81,123,210 (GRCm39) nonsense probably null
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81,110,757 (GRCm39) missense unknown
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8325:Ap3b2 UTSW 7 81,134,237 (GRCm39) splice site probably null
R8697:Ap3b2 UTSW 7 81,122,783 (GRCm39) missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81,117,192 (GRCm39) missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81,123,651 (GRCm39) missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGGTTCTTAAAGTCATGGGG -3'
(R):5'- CCCCTTGTGTATCTAGGTAGAATG -3'

Sequencing Primer
(F):5'- CAGATCTCTGTGAGTTCAAGTCCAG -3'
(R):5'- AGAATGTGTGTCTGTTGGCTATC -3'
Posted On 2021-01-18