Incidental Mutation 'R8356:Cntnap2'
ID 660328
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8356 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 47049373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 44 (H44Q)
Ref Sequence ENSEMBL: ENSMUSP00000142656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000150737]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114641
AA Change: H985Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: H985Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150737
AA Change: H44Q

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142656
Gene: ENSMUSG00000039419
AA Change: H44Q

DomainStartEndE-ValueType
EGF 25 61 1e-1 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T A 5: 113,723,807 M1L unknown Het
AA792892 A G 5: 94,383,844 K196E probably damaging Het
Abcc9 A T 6: 142,590,370 M1546K probably benign Het
Acbd3 T C 1: 180,726,316 M72T probably benign Het
Adam6a T G 12: 113,546,137 L710R probably benign Het
Aldh4a1 T C 4: 139,638,522 S275P probably benign Het
Ap3d1 A T 10: 80,732,903 L47Q probably damaging Het
Arhgap19 G A 19: 41,774,176 R414C probably damaging Het
Ascc3 T C 10: 50,649,907 S572P probably benign Het
Cdk10 G A 8: 123,228,357 R78H probably benign Het
Celsr2 C T 3: 108,413,531 R655H possibly damaging Het
Cpped1 A T 16: 11,894,929 C32* probably null Het
Ddi1 A G 9: 6,266,249 V40A probably benign Het
Ddx50 T C 10: 62,621,508 T588A probably benign Het
Degs2 A G 12: 108,691,964 I252T possibly damaging Het
Dnah1 C T 14: 31,273,015 V2762I probably benign Het
Dnah5 A G 15: 28,444,167 D4037G probably benign Het
Dnah5 C T 15: 28,444,323 A4089V probably null Het
Dthd1 A T 5: 62,849,738 D594V probably damaging Het
Ehmt1 A T 2: 24,852,769 M466K probably benign Het
Erich2 A T 2: 70,527,529 probably null Het
Fam129a T A 1: 151,696,150 V282D probably damaging Het
Fam221b T C 4: 43,665,519 D313G probably benign Het
Fbxl22 T C 9: 66,514,450 D35G possibly damaging Het
Ggcx A G 6: 72,429,591 E679G probably benign Het
Gm14295 A G 2: 176,809,514 T266A probably benign Het
Hnrnpa1 A G 15: 103,242,102 D160G probably null Het
Hnrnpul1 T C 7: 25,722,822 probably benign Het
Hydin A G 8: 110,533,124 E2576G possibly damaging Het
Ifit2 T A 19: 34,573,508 C149* probably null Het
Il18rap T A 1: 40,524,924 S67R probably benign Het
Kcnk4 T G 19: 6,926,300 S294R probably benign Het
Kif21b A G 1: 136,172,945 H1588R probably damaging Het
Klhl35 A T 7: 99,472,922 S77C probably damaging Het
Lats2 A T 14: 57,697,410 M228K probably damaging Het
Lrfn4 T C 19: 4,612,228 D587G probably benign Het
Lrrd1 C A 5: 3,866,509 T842K probably benign Het
Mafb G A 2: 160,366,205 H158Y probably benign Het
Mapk8ip3 T A 17: 24,904,951 E561D probably damaging Het
Mcemp1 A G 8: 3,667,542 T158A probably damaging Het
Mst1r A T 9: 107,917,264 E1214V probably damaging Het
Muc16 A G 9: 18,658,778 I815T unknown Het
Ncoa6 T A 2: 155,406,252 I1711L possibly damaging Het
Neo1 G A 9: 58,878,119 T1408M probably damaging Het
Nnt A C 13: 119,339,832 F632C probably damaging Het
Nup210 G A 6: 91,074,348 T351I probably benign Het
Olfr1312 A G 2: 112,042,598 S145P probably damaging Het
Olfr670 A G 7: 104,960,727 S2P probably benign Het
P4ha1 C T 10: 59,355,363 T364I probably damaging Het
Pcdhb11 T A 18: 37,422,199 L194Q probably damaging Het
Rad51ap1 A G 6: 126,924,916 probably null Het
Rbm11 G A 16: 75,600,806 R208K probably benign Het
Rps6ka1 T A 4: 133,860,057 Q535L possibly damaging Het
Slc26a3 A G 12: 31,466,506 D621G probably benign Het
Sox10 T G 15: 79,156,452 E296A probably damaging Het
St3gal4 A C 9: 35,053,142 V188G probably damaging Het
Trim34a A T 7: 104,260,971 I327F probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Zc2hc1c A G 12: 85,290,697 E376G probably damaging Het
Zfp423 G A 8: 87,783,282 P77S probably damaging Het
Zfp560 A T 9: 20,348,935 S210R probably benign Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R0976:Cntnap2 UTSW 6 47271230 missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 splice site probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46988646 missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47271271 missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46484029 missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47095687 missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46347145 missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47095693 missense probably damaging 0.98
R8479:Cntnap2 UTSW 6 46759773 missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45992041 missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47049222 missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46001227 missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46856142 missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46484049 missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46484205 intron probably benign
R9209:Cntnap2 UTSW 6 47049249 missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46001178 missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46001347 missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46001310 missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46234283 missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46015231 missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45992075 missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46988792 missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46015439 frame shift probably null
R9745:Cntnap2 UTSW 6 46234166 missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47049327 missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47021665 missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47271148 missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46015299 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GAAGCCCTTTGAACTCTGTGC -3'
(R):5'- GTAGGAGAGGAGTTCACTCTACCC -3'

Sequencing Primer
(F):5'- CTGTCATTCCCAGGTGGTGC -3'
(R):5'- GAGGAGTTCACTCTACCCTTAGAAG -3'
Posted On 2021-01-18