Incidental Mutation 'R8356:Cntnap2'
ID 660328
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Name contactin associated protein-like 2
Synonyms 5430425M22Rik, Caspr2
MMRRC Submission 067870-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8356 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 45059357-47304213 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 47049373 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 44 (H44Q)
Ref Sequence ENSEMBL: ENSMUSP00000142656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114641] [ENSMUST00000150737]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114641
AA Change: H985Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: H985Q

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150737
AA Change: H44Q

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000142656
Gene: ENSMUSG00000039419
AA Change: H44Q

DomainStartEndE-ValueType
EGF 25 61 1e-1 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T A 5: 113,723,807 (GRCm38) M1L unknown Het
Abcc9 A T 6: 142,590,370 (GRCm38) M1546K probably benign Het
Acbd3 T C 1: 180,726,316 (GRCm38) M72T probably benign Het
Adam6a T G 12: 113,546,137 (GRCm38) L710R probably benign Het
Aldh4a1 T C 4: 139,638,522 (GRCm38) S275P probably benign Het
Ap3d1 A T 10: 80,732,903 (GRCm38) L47Q probably damaging Het
Arhgap19 G A 19: 41,774,176 (GRCm38) R414C probably damaging Het
Ascc3 T C 10: 50,649,907 (GRCm38) S572P probably benign Het
Cdk10 G A 8: 123,228,357 (GRCm38) R78H probably benign Het
Celsr2 C T 3: 108,413,531 (GRCm38) R655H possibly damaging Het
Cpped1 A T 16: 11,894,929 (GRCm38) C32* probably null Het
Ddi1 A G 9: 6,266,249 (GRCm38) V40A probably benign Het
Ddx50 T C 10: 62,621,508 (GRCm38) T588A probably benign Het
Degs2 A G 12: 108,691,964 (GRCm38) I252T possibly damaging Het
Dnah1 C T 14: 31,273,015 (GRCm38) V2762I probably benign Het
Dnah5 C T 15: 28,444,323 (GRCm38) A4089V probably null Het
Dnah5 A G 15: 28,444,167 (GRCm38) D4037G probably benign Het
Dthd1 A T 5: 62,849,738 (GRCm38) D594V probably damaging Het
Ehmt1 A T 2: 24,852,769 (GRCm38) M466K probably benign Het
Erich2 A T 2: 70,527,529 (GRCm38) probably null Het
Fam221b T C 4: 43,665,519 (GRCm38) D313G probably benign Het
Fbxl22 T C 9: 66,514,450 (GRCm38) D35G possibly damaging Het
Ggcx A G 6: 72,429,591 (GRCm38) E679G probably benign Het
Gm14295 A G 2: 176,809,514 (GRCm38) T266A probably benign Het
Hnrnpa1 A G 15: 103,242,102 (GRCm38) D160G probably null Het
Hnrnpul1 T C 7: 25,722,822 (GRCm38) probably benign Het
Hydin A G 8: 110,533,124 (GRCm38) E2576G possibly damaging Het
Ifit2 T A 19: 34,573,508 (GRCm38) C149* probably null Het
Il18rap T A 1: 40,524,924 (GRCm38) S67R probably benign Het
Kcnk4 T G 19: 6,926,300 (GRCm38) S294R probably benign Het
Kif21b A G 1: 136,172,945 (GRCm38) H1588R probably damaging Het
Klhl35 A T 7: 99,472,922 (GRCm38) S77C probably damaging Het
Lats2 A T 14: 57,697,410 (GRCm38) M228K probably damaging Het
Lrfn4 T C 19: 4,612,228 (GRCm38) D587G probably benign Het
Lrrd1 C A 5: 3,866,509 (GRCm38) T842K probably benign Het
Mafb G A 2: 160,366,205 (GRCm38) H158Y probably benign Het
Mapk8ip3 T A 17: 24,904,951 (GRCm38) E561D probably damaging Het
Mcemp1 A G 8: 3,667,542 (GRCm38) T158A probably damaging Het
Mst1r A T 9: 107,917,264 (GRCm38) E1214V probably damaging Het
Muc16 A G 9: 18,658,778 (GRCm38) I815T unknown Het
Ncoa6 T A 2: 155,406,252 (GRCm38) I1711L possibly damaging Het
Neo1 G A 9: 58,878,119 (GRCm38) T1408M probably damaging Het
Niban1 T A 1: 151,696,150 (GRCm38) V282D probably damaging Het
Nnt A C 13: 119,339,832 (GRCm38) F632C probably damaging Het
Nup210 G A 6: 91,074,348 (GRCm38) T351I probably benign Het
Or4f59 A G 2: 112,042,598 (GRCm38) S145P probably damaging Het
Or52e18 A G 7: 104,960,727 (GRCm38) S2P probably benign Het
P4ha1 C T 10: 59,355,363 (GRCm38) T364I probably damaging Het
Pcdhb11 T A 18: 37,422,199 (GRCm38) L194Q probably damaging Het
Pramel52-ps A G 5: 94,383,844 (GRCm38) K196E probably damaging Het
Rad51ap1 A G 6: 126,924,916 (GRCm38) probably null Het
Rbm11 G A 16: 75,600,806 (GRCm38) R208K probably benign Het
Rps6ka1 T A 4: 133,860,057 (GRCm38) Q535L possibly damaging Het
Slc26a3 A G 12: 31,466,506 (GRCm38) D621G probably benign Het
Sox10 T G 15: 79,156,452 (GRCm38) E296A probably damaging Het
St3gal4 A C 9: 35,053,142 (GRCm38) V188G probably damaging Het
Trim34a A T 7: 104,260,971 (GRCm38) I327F probably damaging Het
Ttc28 G A 5: 111,233,341 (GRCm38) D1240N probably benign Het
Zc2hc1c A G 12: 85,290,697 (GRCm38) E376G probably damaging Het
Zfp423 G A 8: 87,783,282 (GRCm38) P77S probably damaging Het
Zfp560 A T 9: 20,348,935 (GRCm38) S210R probably benign Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46,015,263 (GRCm38) missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46,988,787 (GRCm38) missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47,193,038 (GRCm38) missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46,484,072 (GRCm38) missense probably benign
IGL00857:Cntnap2 APN 6 47,049,424 (GRCm38) missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46,015,465 (GRCm38) missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47,193,013 (GRCm38) missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47,271,371 (GRCm38) nonsense probably null
IGL01859:Cntnap2 APN 6 46,988,721 (GRCm38) missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46,234,203 (GRCm38) missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47,021,654 (GRCm38) missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46,234,320 (GRCm38) missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47,021,736 (GRCm38) missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47,095,549 (GRCm38) missense possibly damaging 0.66
BB004:Cntnap2 UTSW 6 47,095,687 (GRCm38) missense possibly damaging 0.93
BB014:Cntnap2 UTSW 6 47,095,687 (GRCm38) missense possibly damaging 0.93
IGL02802:Cntnap2 UTSW 6 46,170,245 (GRCm38) missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46,530,171 (GRCm38) missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45,992,073 (GRCm38) missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45,992,073 (GRCm38) missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46,483,983 (GRCm38) missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45,060,392 (GRCm38) splice site probably null
R0352:Cntnap2 UTSW 6 45,992,084 (GRCm38) splice site probably null
R0389:Cntnap2 UTSW 6 46,009,637 (GRCm38) missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45,715,816 (GRCm38) missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46,529,905 (GRCm38) nonsense probably null
R0611:Cntnap2 UTSW 6 47,095,549 (GRCm38) missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46,988,760 (GRCm38) missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47,296,708 (GRCm38) splice site probably benign
R0976:Cntnap2 UTSW 6 47,271,230 (GRCm38) missense probably damaging 1.00
R1195:Cntnap2 UTSW 6 46,483,968 (GRCm38) missense probably benign
R1195:Cntnap2 UTSW 6 46,483,968 (GRCm38) missense probably benign
R1195:Cntnap2 UTSW 6 46,483,968 (GRCm38) missense probably benign
R1387:Cntnap2 UTSW 6 47,107,914 (GRCm38) missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46,530,679 (GRCm38) missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46,015,330 (GRCm38) missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47,107,892 (GRCm38) nonsense probably null
R1757:Cntnap2 UTSW 6 46,759,829 (GRCm38) missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46,988,675 (GRCm38) missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46,530,633 (GRCm38) missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47,298,588 (GRCm38) missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47,298,445 (GRCm38) missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46,015,266 (GRCm38) missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45,991,903 (GRCm38) missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46,856,128 (GRCm38) missense probably benign
R4030:Cntnap2 UTSW 6 46,856,128 (GRCm38) missense probably benign
R4237:Cntnap2 UTSW 6 46,530,390 (GRCm38) intron probably benign
R4445:Cntnap2 UTSW 6 46,759,851 (GRCm38) missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45,060,317 (GRCm38) missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45,060,317 (GRCm38) missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46,530,035 (GRCm38) intron probably benign
R4918:Cntnap2 UTSW 6 46,530,035 (GRCm38) intron probably benign
R4999:Cntnap2 UTSW 6 45,920,834 (GRCm38) missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47,107,969 (GRCm38) missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47,107,969 (GRCm38) missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45,920,926 (GRCm38) nonsense probably null
R5748:Cntnap2 UTSW 6 45,715,884 (GRCm38) missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46,529,815 (GRCm38) intron probably benign
R6118:Cntnap2 UTSW 6 47,193,077 (GRCm38) missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46,759,808 (GRCm38) missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47,271,298 (GRCm38) missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45,060,112 (GRCm38) splice site probably null
R6385:Cntnap2 UTSW 6 46,856,180 (GRCm38) missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46,759,760 (GRCm38) missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46,170,272 (GRCm38) missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46,015,257 (GRCm38) missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47,049,373 (GRCm38) missense probably benign 0.03
R7125:Cntnap2 UTSW 6 46,988,646 (GRCm38) missense probably benign 0.12
R7329:Cntnap2 UTSW 6 47,271,271 (GRCm38) missense possibly damaging 0.94
R7502:Cntnap2 UTSW 6 46,484,029 (GRCm38) missense possibly damaging 0.83
R7927:Cntnap2 UTSW 6 47,095,687 (GRCm38) missense possibly damaging 0.93
R8057:Cntnap2 UTSW 6 46,347,145 (GRCm38) missense probably damaging 0.98
R8261:Cntnap2 UTSW 6 47,095,693 (GRCm38) missense probably damaging 0.98
R8479:Cntnap2 UTSW 6 46,759,773 (GRCm38) missense probably benign 0.14
R8503:Cntnap2 UTSW 6 45,992,041 (GRCm38) missense probably damaging 1.00
R8698:Cntnap2 UTSW 6 47,049,222 (GRCm38) missense probably damaging 1.00
R8719:Cntnap2 UTSW 6 46,001,227 (GRCm38) missense probably damaging 1.00
R8816:Cntnap2 UTSW 6 46,856,142 (GRCm38) missense possibly damaging 0.72
R8987:Cntnap2 UTSW 6 46,484,049 (GRCm38) missense probably benign 0.01
R9000:Cntnap2 UTSW 6 46,484,205 (GRCm38) intron probably benign
R9209:Cntnap2 UTSW 6 47,049,249 (GRCm38) missense probably damaging 1.00
R9253:Cntnap2 UTSW 6 46,001,178 (GRCm38) missense probably benign 0.00
R9310:Cntnap2 UTSW 6 46,001,347 (GRCm38) missense probably damaging 1.00
R9395:Cntnap2 UTSW 6 46,001,310 (GRCm38) missense probably damaging 0.98
R9462:Cntnap2 UTSW 6 46,234,283 (GRCm38) missense probably damaging 0.99
R9526:Cntnap2 UTSW 6 46,015,231 (GRCm38) missense probably damaging 1.00
R9600:Cntnap2 UTSW 6 45,992,075 (GRCm38) missense probably damaging 0.98
R9621:Cntnap2 UTSW 6 46,988,792 (GRCm38) missense probably damaging 0.98
R9738:Cntnap2 UTSW 6 46,015,439 (GRCm38) frame shift probably null
R9745:Cntnap2 UTSW 6 46,234,166 (GRCm38) missense probably benign 0.01
R9775:Cntnap2 UTSW 6 47,049,327 (GRCm38) missense probably damaging 1.00
RF022:Cntnap2 UTSW 6 47,021,665 (GRCm38) missense probably damaging 1.00
X0018:Cntnap2 UTSW 6 46,009,518 (GRCm38) missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47,021,754 (GRCm38) missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46,234,245 (GRCm38) missense probably benign 0.03
Z1176:Cntnap2 UTSW 6 47,271,148 (GRCm38) missense probably benign 0.00
Z1177:Cntnap2 UTSW 6 46,015,299 (GRCm38) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GAAGCCCTTTGAACTCTGTGC -3'
(R):5'- GTAGGAGAGGAGTTCACTCTACCC -3'

Sequencing Primer
(F):5'- CTGTCATTCCCAGGTGGTGC -3'
(R):5'- GAGGAGTTCACTCTACCCTTAGAAG -3'
Posted On 2021-01-18