Incidental Mutation 'R8356:Neo1'
ID 660345
Institutional Source Beutler Lab
Gene Symbol Neo1
Ensembl Gene ENSMUSG00000032340
Gene Name neogenin
Synonyms 2610028H22Rik, D930014N22Rik, Igdcc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8356 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 58874687-59036441 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 58878119 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1408 (T1408M)
Ref Sequence ENSEMBL: ENSMUSP00000150600 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068664] [ENSMUST00000214547]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068664
AA Change: T1435M

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063656
Gene: ENSMUSG00000032340
AA Change: T1435M

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
IGc2 76 147 9.49e-5 SMART
IGc2 175 239 4.43e-5 SMART
IGc2 272 338 6.15e-13 SMART
IGc2 364 428 7.76e-10 SMART
low complexity region 446 458 N/A INTRINSIC
FN3 470 553 8.23e-12 SMART
FN3 570 649 1.78e-16 SMART
FN3 665 749 1.54e-11 SMART
FN3 770 849 5.27e-10 SMART
FN3 885 970 7.63e-7 SMART
FN3 986 1072 2.78e-9 SMART
transmembrane domain 1136 1158 N/A INTRINSIC
Pfam:Neogenin_C 1189 1492 1.9e-122 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214547
AA Change: T1408M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface protein that is a member of the immunoglobulin superfamily. The encoded protein consists of four N-terminal immunoglobulin-like domains, six fibronectin type III domains, a transmembrane domain and a C-terminal internal domain that shares homology with the tumor suppressor candidate gene DCC. This protein may be involved in cell growth and differentiation and in cell-cell adhesion. Defects in this gene are associated with cell proliferation in certain cancers. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display perinatal lethality and abnormal trigeminal nerve development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T A 5: 113,723,807 M1L unknown Het
AA792892 A G 5: 94,383,844 K196E probably damaging Het
Abcc9 A T 6: 142,590,370 M1546K probably benign Het
Acbd3 T C 1: 180,726,316 M72T probably benign Het
Adam6a T G 12: 113,546,137 L710R probably benign Het
Aldh4a1 T C 4: 139,638,522 S275P probably benign Het
Ap3d1 A T 10: 80,732,903 L47Q probably damaging Het
Arhgap19 G A 19: 41,774,176 R414C probably damaging Het
Ascc3 T C 10: 50,649,907 S572P probably benign Het
Cdk10 G A 8: 123,228,357 R78H probably benign Het
Celsr2 C T 3: 108,413,531 R655H possibly damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Cpped1 A T 16: 11,894,929 C32* probably null Het
Ddi1 A G 9: 6,266,249 V40A probably benign Het
Ddx50 T C 10: 62,621,508 T588A probably benign Het
Degs2 A G 12: 108,691,964 I252T possibly damaging Het
Dnah1 C T 14: 31,273,015 V2762I probably benign Het
Dnah5 A G 15: 28,444,167 D4037G probably benign Het
Dnah5 C T 15: 28,444,323 A4089V probably null Het
Dthd1 A T 5: 62,849,738 D594V probably damaging Het
Ehmt1 A T 2: 24,852,769 M466K probably benign Het
Erich2 A T 2: 70,527,529 probably null Het
Fam129a T A 1: 151,696,150 V282D probably damaging Het
Fam221b T C 4: 43,665,519 D313G probably benign Het
Fbxl22 T C 9: 66,514,450 D35G possibly damaging Het
Ggcx A G 6: 72,429,591 E679G probably benign Het
Gm14295 A G 2: 176,809,514 T266A probably benign Het
Hnrnpa1 A G 15: 103,242,102 D160G probably null Het
Hnrnpul1 T C 7: 25,722,822 probably benign Het
Hydin A G 8: 110,533,124 E2576G possibly damaging Het
Ifit2 T A 19: 34,573,508 C149* probably null Het
Il18rap T A 1: 40,524,924 S67R probably benign Het
Kcnk4 T G 19: 6,926,300 S294R probably benign Het
Kif21b A G 1: 136,172,945 H1588R probably damaging Het
Klhl35 A T 7: 99,472,922 S77C probably damaging Het
Lats2 A T 14: 57,697,410 M228K probably damaging Het
Lrfn4 T C 19: 4,612,228 D587G probably benign Het
Lrrd1 C A 5: 3,866,509 T842K probably benign Het
Mafb G A 2: 160,366,205 H158Y probably benign Het
Mapk8ip3 T A 17: 24,904,951 E561D probably damaging Het
Mcemp1 A G 8: 3,667,542 T158A probably damaging Het
Mst1r A T 9: 107,917,264 E1214V probably damaging Het
Muc16 A G 9: 18,658,778 I815T unknown Het
Ncoa6 T A 2: 155,406,252 I1711L possibly damaging Het
Nnt A C 13: 119,339,832 F632C probably damaging Het
Nup210 G A 6: 91,074,348 T351I probably benign Het
Olfr1312 A G 2: 112,042,598 S145P probably damaging Het
Olfr670 A G 7: 104,960,727 S2P probably benign Het
P4ha1 C T 10: 59,355,363 T364I probably damaging Het
Pcdhb11 T A 18: 37,422,199 L194Q probably damaging Het
Rad51ap1 A G 6: 126,924,916 probably null Het
Rbm11 G A 16: 75,600,806 R208K probably benign Het
Rps6ka1 T A 4: 133,860,057 Q535L possibly damaging Het
Slc26a3 A G 12: 31,466,506 D621G probably benign Het
Sox10 T G 15: 79,156,452 E296A probably damaging Het
St3gal4 A C 9: 35,053,142 V188G probably damaging Het
Trim34a A T 7: 104,260,971 I327F probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Zc2hc1c A G 12: 85,290,697 E376G probably damaging Het
Zfp423 G A 8: 87,783,282 P77S probably damaging Het
Zfp560 A T 9: 20,348,935 S210R probably benign Het
Other mutations in Neo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Neo1 APN 9 58921919 splice site probably benign
IGL00885:Neo1 APN 9 58888463 missense probably damaging 1.00
IGL01103:Neo1 APN 9 58880799 missense possibly damaging 0.60
IGL01322:Neo1 APN 9 58907085 missense possibly damaging 0.68
IGL02216:Neo1 APN 9 58917053 missense probably damaging 0.96
IGL02327:Neo1 APN 9 58903088 missense probably benign 0.08
IGL02392:Neo1 APN 9 58925811 missense possibly damaging 0.49
IGL02458:Neo1 APN 9 58893867 splice site probably benign
IGL03057:Neo1 APN 9 58878059 missense probably damaging 1.00
IGL03091:Neo1 APN 9 58978668 missense probably damaging 0.98
IGL03193:Neo1 APN 9 58908484 missense probably damaging 1.00
R0097:Neo1 UTSW 9 58882021 intron probably benign
R0419:Neo1 UTSW 9 58990180 splice site probably benign
R0571:Neo1 UTSW 9 58985786 missense probably benign
R0646:Neo1 UTSW 9 58931034 missense probably damaging 1.00
R0736:Neo1 UTSW 9 58917081 missense possibly damaging 0.78
R0739:Neo1 UTSW 9 58921877 missense probably benign 0.22
R1636:Neo1 UTSW 9 58913277 missense probably damaging 1.00
R1694:Neo1 UTSW 9 58880603 missense probably damaging 1.00
R1827:Neo1 UTSW 9 58917031 nonsense probably null
R1927:Neo1 UTSW 9 58990385 missense probably benign 0.12
R2354:Neo1 UTSW 9 58985634 missense probably benign
R2365:Neo1 UTSW 9 58956003 missense probably benign
R3156:Neo1 UTSW 9 58888979 splice site probably null
R3552:Neo1 UTSW 9 58893878 missense probably damaging 1.00
R3829:Neo1 UTSW 9 58913169 missense possibly damaging 0.58
R4477:Neo1 UTSW 9 58877299 missense probably damaging 0.99
R4613:Neo1 UTSW 9 58889041 missense possibly damaging 0.94
R5023:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5046:Neo1 UTSW 9 58893911 missense possibly damaging 0.77
R5057:Neo1 UTSW 9 58990271 missense probably damaging 1.00
R5323:Neo1 UTSW 9 58906648 critical splice donor site probably null
R5394:Neo1 UTSW 9 58990234 missense probably benign 0.10
R5470:Neo1 UTSW 9 58931067 missense probably damaging 1.00
R5473:Neo1 UTSW 9 58880843 missense possibly damaging 0.88
R5500:Neo1 UTSW 9 58917054 missense possibly damaging 0.94
R5503:Neo1 UTSW 9 58985650 missense possibly damaging 0.67
R6122:Neo1 UTSW 9 58917008 missense probably benign
R6191:Neo1 UTSW 9 58889029 missense probably damaging 1.00
R6431:Neo1 UTSW 9 58907071 missense probably benign 0.27
R6560:Neo1 UTSW 9 58880601 missense possibly damaging 0.95
R6658:Neo1 UTSW 9 58921849 missense probably benign 0.14
R6772:Neo1 UTSW 9 58902976 missense probably damaging 1.00
R6912:Neo1 UTSW 9 58917052 missense probably benign 0.00
R7061:Neo1 UTSW 9 58990441 missense possibly damaging 0.95
R7145:Neo1 UTSW 9 58889179 missense probably damaging 1.00
R7156:Neo1 UTSW 9 58902923 missense probably damaging 1.00
R7485:Neo1 UTSW 9 58884543 missense probably benign 0.04
R7519:Neo1 UTSW 9 58878065 missense probably benign 0.13
R7615:Neo1 UTSW 9 58884503 missense probably benign 0.07
R7665:Neo1 UTSW 9 58925795 missense probably damaging 1.00
R7695:Neo1 UTSW 9 58902929 missense possibly damaging 0.81
R7753:Neo1 UTSW 9 58956005 missense probably benign 0.00
R7807:Neo1 UTSW 9 58990494 missense probably benign 0.01
R7915:Neo1 UTSW 9 58930981 missense probably benign 0.42
R7973:Neo1 UTSW 9 58990193 missense probably damaging 1.00
R8505:Neo1 UTSW 9 58913283 missense probably benign 0.02
R8700:Neo1 UTSW 9 58918630 missense probably benign 0.28
R8798:Neo1 UTSW 9 58913166 missense probably damaging 1.00
R8952:Neo1 UTSW 9 58990262 missense probably benign 0.01
R9779:Neo1 UTSW 9 58978726 nonsense probably null
R9784:Neo1 UTSW 9 58982220 missense probably benign
R9789:Neo1 UTSW 9 58894024 critical splice acceptor site probably null
X0063:Neo1 UTSW 9 58990298 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAAGGACACCTGTTTGATG -3'
(R):5'- TCAGAGCAGATCCCTGTCTG -3'

Sequencing Primer
(F):5'- ATCTATGGTGGCAAAGACCTC -3'
(R):5'- GATCCCTGTCTGAGCCTACAAG -3'
Posted On 2021-01-18