Incidental Mutation 'R8356:Adam6a'
ID 660355
Institutional Source Beutler Lab
Gene Symbol Adam6a
Ensembl Gene ENSMUSG00000043945
Gene Name a disintegrin and metallopeptidase domain 6A
Synonyms Adam6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock # R8356 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 113543908-113546465 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 113546137 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 710 (L710R)
Ref Sequence ENSEMBL: ENSMUSP00000059315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053086]
AlphaFold B2RSY5
Predicted Effect probably benign
Transcript: ENSMUST00000053086
AA Change: L710R

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000059315
Gene: ENSMUSG00000043945
AA Change: L710R

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 30 167 6.9e-17 PFAM
Pfam:Reprolysin 222 407 4e-15 PFAM
DISIN 427 502 1.63e-33 SMART
ACR 503 640 7.46e-62 SMART
transmembrane domain 704 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik T A 5: 113,723,807 M1L unknown Het
AA792892 A G 5: 94,383,844 K196E probably damaging Het
Abcc9 A T 6: 142,590,370 M1546K probably benign Het
Acbd3 T C 1: 180,726,316 M72T probably benign Het
Aldh4a1 T C 4: 139,638,522 S275P probably benign Het
Ap3d1 A T 10: 80,732,903 L47Q probably damaging Het
Arhgap19 G A 19: 41,774,176 R414C probably damaging Het
Ascc3 T C 10: 50,649,907 S572P probably benign Het
Cdk10 G A 8: 123,228,357 R78H probably benign Het
Celsr2 C T 3: 108,413,531 R655H possibly damaging Het
Cntnap2 T A 6: 47,049,373 H44Q probably benign Het
Cpped1 A T 16: 11,894,929 C32* probably null Het
Ddi1 A G 9: 6,266,249 V40A probably benign Het
Ddx50 T C 10: 62,621,508 T588A probably benign Het
Degs2 A G 12: 108,691,964 I252T possibly damaging Het
Dnah1 C T 14: 31,273,015 V2762I probably benign Het
Dnah5 A G 15: 28,444,167 D4037G probably benign Het
Dnah5 C T 15: 28,444,323 A4089V probably null Het
Dthd1 A T 5: 62,849,738 D594V probably damaging Het
Ehmt1 A T 2: 24,852,769 M466K probably benign Het
Erich2 A T 2: 70,527,529 probably null Het
Fam129a T A 1: 151,696,150 V282D probably damaging Het
Fam221b T C 4: 43,665,519 D313G probably benign Het
Fbxl22 T C 9: 66,514,450 D35G possibly damaging Het
Ggcx A G 6: 72,429,591 E679G probably benign Het
Gm14295 A G 2: 176,809,514 T266A probably benign Het
Hnrnpa1 A G 15: 103,242,102 D160G probably null Het
Hnrnpul1 T C 7: 25,722,822 probably benign Het
Hydin A G 8: 110,533,124 E2576G possibly damaging Het
Ifit2 T A 19: 34,573,508 C149* probably null Het
Il18rap T A 1: 40,524,924 S67R probably benign Het
Kcnk4 T G 19: 6,926,300 S294R probably benign Het
Kif21b A G 1: 136,172,945 H1588R probably damaging Het
Klhl35 A T 7: 99,472,922 S77C probably damaging Het
Lats2 A T 14: 57,697,410 M228K probably damaging Het
Lrfn4 T C 19: 4,612,228 D587G probably benign Het
Lrrd1 C A 5: 3,866,509 T842K probably benign Het
Mafb G A 2: 160,366,205 H158Y probably benign Het
Mapk8ip3 T A 17: 24,904,951 E561D probably damaging Het
Mcemp1 A G 8: 3,667,542 T158A probably damaging Het
Mst1r A T 9: 107,917,264 E1214V probably damaging Het
Muc16 A G 9: 18,658,778 I815T unknown Het
Ncoa6 T A 2: 155,406,252 I1711L possibly damaging Het
Neo1 G A 9: 58,878,119 T1408M probably damaging Het
Nnt A C 13: 119,339,832 F632C probably damaging Het
Nup210 G A 6: 91,074,348 T351I probably benign Het
Olfr1312 A G 2: 112,042,598 S145P probably damaging Het
Olfr670 A G 7: 104,960,727 S2P probably benign Het
P4ha1 C T 10: 59,355,363 T364I probably damaging Het
Pcdhb11 T A 18: 37,422,199 L194Q probably damaging Het
Rad51ap1 A G 6: 126,924,916 probably null Het
Rbm11 G A 16: 75,600,806 R208K probably benign Het
Rps6ka1 T A 4: 133,860,057 Q535L possibly damaging Het
Slc26a3 A G 12: 31,466,506 D621G probably benign Het
Sox10 T G 15: 79,156,452 E296A probably damaging Het
St3gal4 A C 9: 35,053,142 V188G probably damaging Het
Trim34a A T 7: 104,260,971 I327F probably damaging Het
Ttc28 G A 5: 111,233,341 D1240N probably benign Het
Zc2hc1c A G 12: 85,290,697 E376G probably damaging Het
Zfp423 G A 8: 87,783,282 P77S probably damaging Het
Zfp560 A T 9: 20,348,935 S210R probably benign Het
Other mutations in Adam6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Adam6a APN 12 113545225 missense probably benign 0.00
IGL00896:Adam6a APN 12 113545410 missense possibly damaging 0.56
IGL01146:Adam6a APN 12 113544220 missense probably damaging 1.00
IGL01285:Adam6a APN 12 113546273 makesense probably null
IGL01839:Adam6a APN 12 113544622 missense probably benign 0.03
IGL01906:Adam6a APN 12 113544331 missense probably benign 0.19
IGL02306:Adam6a APN 12 113545723 missense possibly damaging 0.93
IGL03146:Adam6a APN 12 113545524 missense probably damaging 1.00
IGL03176:Adam6a APN 12 113546202 missense probably benign 0.00
IGL03365:Adam6a APN 12 113544145 missense possibly damaging 0.86
IGL03373:Adam6a APN 12 113545552 missense possibly damaging 0.55
PIT4802001:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R0091:Adam6a UTSW 12 113544229 missense possibly damaging 0.46
R0149:Adam6a UTSW 12 113545749 missense probably damaging 1.00
R0348:Adam6a UTSW 12 113544717 missense probably damaging 0.99
R0376:Adam6a UTSW 12 113544690 missense probably damaging 1.00
R1471:Adam6a UTSW 12 113544393 missense probably damaging 1.00
R1474:Adam6a UTSW 12 113544449 missense possibly damaging 0.66
R1553:Adam6a UTSW 12 113545215 missense probably damaging 1.00
R1679:Adam6a UTSW 12 113544756 missense probably benign 0.00
R1808:Adam6a UTSW 12 113544714 missense probably benign 0.00
R1826:Adam6a UTSW 12 113546122 missense possibly damaging 0.46
R1856:Adam6a UTSW 12 113545303 missense probably damaging 1.00
R1916:Adam6a UTSW 12 113545936 missense probably benign
R2011:Adam6a UTSW 12 113545378 missense probably benign 0.09
R2049:Adam6a UTSW 12 113544429 missense probably benign 0.17
R2364:Adam6a UTSW 12 113544630 missense probably benign 0.05
R3820:Adam6a UTSW 12 113544178 missense probably benign 0.00
R4119:Adam6a UTSW 12 113544574 missense probably benign 0.06
R4540:Adam6a UTSW 12 113544499 missense probably damaging 1.00
R4627:Adam6a UTSW 12 113544949 missense probably benign
R4665:Adam6a UTSW 12 113544372 missense possibly damaging 0.64
R4859:Adam6a UTSW 12 113545989 missense probably damaging 1.00
R4997:Adam6a UTSW 12 113545371 missense probably damaging 1.00
R5270:Adam6a UTSW 12 113544127 missense possibly damaging 0.46
R5751:Adam6a UTSW 12 113544827 missense possibly damaging 0.79
R5775:Adam6a UTSW 12 113546266 missense possibly damaging 0.47
R5863:Adam6a UTSW 12 113544367 missense probably benign 0.01
R6154:Adam6a UTSW 12 113545672 missense probably benign 0.11
R6313:Adam6a UTSW 12 113545050 missense possibly damaging 0.56
R6316:Adam6a UTSW 12 113545576 missense probably benign 0.27
R6706:Adam6a UTSW 12 113545266 missense probably benign 0.00
R6845:Adam6a UTSW 12 113544097 missense possibly damaging 0.96
R7134:Adam6a UTSW 12 113545035 missense probably benign 0.04
R7179:Adam6a UTSW 12 113545671 missense probably benign 0.02
R7206:Adam6a UTSW 12 113546034 missense probably damaging 1.00
R7230:Adam6a UTSW 12 113545582 missense probably damaging 1.00
R7296:Adam6a UTSW 12 113545572 missense probably damaging 1.00
R7676:Adam6a UTSW 12 113544576 missense probably benign 0.00
R7730:Adam6a UTSW 12 113544040 missense possibly damaging 0.86
R7743:Adam6a UTSW 12 113544532 missense probably benign
R7841:Adam6a UTSW 12 113545458 missense probably damaging 1.00
R8531:Adam6a UTSW 12 113545297 missense probably damaging 1.00
R9568:Adam6a UTSW 12 113544400 missense possibly damaging 0.74
R9624:Adam6a UTSW 12 113545450 missense probably damaging 1.00
R9679:Adam6a UTSW 12 113545922 missense probably benign 0.00
R9680:Adam6a UTSW 12 113545864 nonsense probably null
X0027:Adam6a UTSW 12 113545243 missense probably benign 0.01
Z1176:Adam6a UTSW 12 113545321 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTGGGTTATGACTGCACCCC -3'
(R):5'- ACCTTGTCCCCTAATGACATTCAG -3'

Sequencing Primer
(F):5'- GGTTATGACTGCACCCCAGAAAAATG -3'
(R):5'- GCAGCTTGCAAGTCTTCA -3'
Posted On 2021-01-18