Incidental Mutation 'R8440:Zfp592'
ID 660386
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Name zinc finger protein 592
Synonyms A730014M16Rik
MMRRC Submission 067884-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.926) question?
Stock # R8440 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80643432-80694912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 80691271 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1150 (S1150T)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
AlphaFold Q8BHZ4
Predicted Effect possibly damaging
Transcript: ENSMUST00000107353
AA Change: S1150T

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: S1150T

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G C 3: 152,209,680 (GRCm39) probably null Het
Bbs9 T A 9: 22,479,046 (GRCm39) V163E probably damaging Het
Bsn G A 9: 107,988,651 (GRCm39) A2367V probably benign Het
Cbr3 T C 16: 93,480,421 (GRCm39) I70T probably damaging Het
Chka T C 19: 3,943,375 (GRCm39) Y426H probably damaging Het
Cpq T A 15: 33,213,341 (GRCm39) M120K possibly damaging Het
Dcaf1 T A 9: 106,725,073 (GRCm39) C520S possibly damaging Het
Egfr T C 11: 16,859,831 (GRCm39) Y1018H probably damaging Het
Eif3l T C 15: 78,961,120 (GRCm39) Y58H possibly damaging Het
Frmd8 T C 19: 5,915,202 (GRCm39) Y234C possibly damaging Het
Fus T C 7: 127,568,998 (GRCm39) Y50H unknown Het
Hmcn1 T A 1: 150,570,671 (GRCm39) Q2164L probably damaging Het
Hmcn2 C A 2: 31,281,088 (GRCm39) L1867I probably benign Het
Hsd11b1 T C 1: 192,904,420 (GRCm39) K260E probably benign Het
Igkv4-91 C T 6: 68,745,556 (GRCm39) G114D probably benign Het
Inpp4b G A 8: 82,768,524 (GRCm39) E678K probably damaging Het
Kifc3 G T 8: 95,836,422 (GRCm39) P113Q possibly damaging Het
Lgi4 T A 7: 30,760,049 (GRCm39) probably null Het
Map1s A G 8: 71,365,163 (GRCm39) N107D probably damaging Het
Meiob G T 17: 25,037,302 (GRCm39) C60F probably benign Het
Nedd4l G T 18: 65,022,126 (GRCm39) probably null Het
Omp A G 7: 97,794,253 (GRCm39) F125L probably damaging Het
Or1ad6 T C 11: 50,860,024 (GRCm39) Y60H probably damaging Het
Or51h1 G A 7: 102,308,275 (GRCm39) M82I probably damaging Het
Or5a1 C T 19: 12,097,308 (GRCm39) C244Y probably damaging Het
Pcdha3 T C 18: 37,080,914 (GRCm39) V552A probably damaging Het
Plek T C 11: 16,945,276 (GRCm39) D18G possibly damaging Het
Ppip5k2 T C 1: 97,675,276 (GRCm39) T376A probably damaging Het
Prkdc CAAA CAAAA 16: 15,653,022 (GRCm39) 3833 probably null Het
Rabgap1 T C 2: 37,432,692 (GRCm39) probably null Het
Rtn1 T A 12: 72,270,173 (GRCm39) I113F probably damaging Het
Ssu2 T A 6: 112,364,950 (GRCm39) D4V probably benign Het
St6galnac2 T C 11: 116,568,374 (GRCm39) H363R probably damaging Het
Stk19 T C 17: 35,055,456 (GRCm39) S60G possibly damaging Het
Suco G A 1: 161,679,907 (GRCm39) T332I probably damaging Het
Trbv20 T A 6: 41,165,892 (GRCm39) Y106N probably damaging Het
Uck1 C A 2: 32,150,153 (GRCm39) probably benign Het
Vmn1r128 G A 7: 21,083,745 (GRCm39) V150I probably benign Het
Vmn2r54 A T 7: 12,350,013 (GRCm39) V523E possibly damaging Het
Vmn2r61 A T 7: 41,916,080 (GRCm39) E231V probably benign Het
Xkr9 A G 1: 13,771,603 (GRCm39) D373G probably benign Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 80,691,296 (GRCm39) nonsense probably null
IGL01984:Zfp592 APN 7 80,688,392 (GRCm39) missense probably benign 0.00
IGL02079:Zfp592 APN 7 80,688,978 (GRCm39) missense probably benign 0.20
IGL02096:Zfp592 APN 7 80,674,796 (GRCm39) missense probably damaging 1.00
IGL02125:Zfp592 APN 7 80,687,932 (GRCm39) missense probably benign 0.00
IGL02374:Zfp592 APN 7 80,674,731 (GRCm39) missense probably damaging 1.00
IGL02419:Zfp592 APN 7 80,687,993 (GRCm39) missense probably damaging 1.00
IGL02466:Zfp592 APN 7 80,673,746 (GRCm39) missense probably damaging 1.00
IGL02485:Zfp592 APN 7 80,687,718 (GRCm39) splice site probably benign
IGL02500:Zfp592 APN 7 80,691,474 (GRCm39) missense probably benign
IGL02876:Zfp592 APN 7 80,687,875 (GRCm39) missense probably benign 0.01
IGL02940:Zfp592 APN 7 80,674,575 (GRCm39) missense probably damaging 1.00
R0326:Zfp592 UTSW 7 80,674,637 (GRCm39) missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 80,687,819 (GRCm39) missense probably damaging 1.00
R0684:Zfp592 UTSW 7 80,687,623 (GRCm39) missense probably benign 0.00
R0750:Zfp592 UTSW 7 80,674,493 (GRCm39) missense probably benign
R1346:Zfp592 UTSW 7 80,687,812 (GRCm39) missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 80,674,227 (GRCm39) missense probably damaging 0.99
R1650:Zfp592 UTSW 7 80,687,848 (GRCm39) missense probably benign 0.04
R1804:Zfp592 UTSW 7 80,673,443 (GRCm39) missense probably damaging 1.00
R1918:Zfp592 UTSW 7 80,687,168 (GRCm39) nonsense probably null
R2114:Zfp592 UTSW 7 80,674,544 (GRCm39) missense probably damaging 1.00
R2144:Zfp592 UTSW 7 80,687,950 (GRCm39) missense probably benign 0.01
R2164:Zfp592 UTSW 7 80,691,186 (GRCm39) missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 80,691,361 (GRCm39) missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 80,687,159 (GRCm39) nonsense probably null
R3809:Zfp592 UTSW 7 80,674,280 (GRCm39) missense probably benign 0.00
R4574:Zfp592 UTSW 7 80,673,534 (GRCm39) missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 80,691,607 (GRCm39) missense probably damaging 1.00
R5023:Zfp592 UTSW 7 80,674,095 (GRCm39) missense probably damaging 1.00
R5121:Zfp592 UTSW 7 80,673,309 (GRCm39) missense probably damaging 1.00
R5174:Zfp592 UTSW 7 80,688,073 (GRCm39) missense probably damaging 1.00
R5794:Zfp592 UTSW 7 80,674,781 (GRCm39) missense probably benign 0.00
R5946:Zfp592 UTSW 7 80,687,645 (GRCm39) missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 80,673,184 (GRCm39) missense probably benign 0.05
R6657:Zfp592 UTSW 7 80,675,234 (GRCm39) missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R6872:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R7056:Zfp592 UTSW 7 80,673,067 (GRCm39) missense probably damaging 1.00
R7295:Zfp592 UTSW 7 80,674,070 (GRCm39) missense probably damaging 1.00
R7351:Zfp592 UTSW 7 80,691,439 (GRCm39) missense probably benign 0.00
R7475:Zfp592 UTSW 7 80,673,200 (GRCm39) missense probably damaging 0.99
R7509:Zfp592 UTSW 7 80,688,088 (GRCm39) missense probably damaging 0.99
R7552:Zfp592 UTSW 7 80,673,390 (GRCm39) missense probably benign 0.01
R7737:Zfp592 UTSW 7 80,674,941 (GRCm39) missense probably damaging 1.00
R7752:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R7901:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R8100:Zfp592 UTSW 7 80,673,940 (GRCm39) missense probably benign 0.05
R8710:Zfp592 UTSW 7 80,673,321 (GRCm39) missense probably damaging 1.00
R8766:Zfp592 UTSW 7 80,674,353 (GRCm39) missense probably benign 0.00
R9083:Zfp592 UTSW 7 80,674,644 (GRCm39) missense possibly damaging 0.95
R9141:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9194:Zfp592 UTSW 7 80,674,349 (GRCm39) missense probably benign
R9197:Zfp592 UTSW 7 80,674,067 (GRCm39) missense possibly damaging 0.73
R9246:Zfp592 UTSW 7 80,691,529 (GRCm39) missense probably benign 0.03
R9321:Zfp592 UTSW 7 80,691,226 (GRCm39) missense possibly damaging 0.65
R9426:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9785:Zfp592 UTSW 7 80,673,245 (GRCm39) missense probably damaging 1.00
X0022:Zfp592 UTSW 7 80,687,935 (GRCm39) nonsense probably null
X0028:Zfp592 UTSW 7 80,673,762 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTTCCAGGTGAACCATCTG -3'
(R):5'- GGCTCACTGGCACATTCTTC -3'

Sequencing Primer
(F):5'- GGTGAACCATCTGAAAAGACCTGTC -3'
(R):5'- ACTGGCACATTCTTCCAGTC -3'
Posted On 2021-01-18