Incidental Mutation 'R8440:Chka'
ID 660408
Institutional Source Beutler Lab
Gene Symbol Chka
Ensembl Gene ENSMUSG00000024843
Gene Name choline kinase alpha
Synonyms choline/ethanolamine kinase alpha, EtnK-alpha, CK/EK-alpha, Chk, ChoK
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8440 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 3851773-3894369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 3893375 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 426 (Y426H)
Ref Sequence ENSEMBL: ENSMUSP00000071933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001801] [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000122885] [ENSMUST00000126070] [ENSMUST00000128694] [ENSMUST00000135070] [ENSMUST00000145791] [ENSMUST00000153343]
AlphaFold O54804
Predicted Effect probably benign
Transcript: ENSMUST00000001801
SMART Domains Protein: ENSMUSP00000001801
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025760
AA Change: Y444H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843
AA Change: Y444H

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 373 2.4e-11 PFAM
Pfam:Choline_kinase 135 370 8.2e-82 PFAM
Pfam:EcKinase 211 345 2.5e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000072055
AA Change: Y426H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843
AA Change: Y426H

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 358 6.4e-12 PFAM
Pfam:Choline_kinase 135 352 1.6e-84 PFAM
Pfam:EcKinase 190 329 2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122885
SMART Domains Protein: ENSMUSP00000114768
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 91 2.9e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126070
SMART Domains Protein: ENSMUSP00000120531
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 1.2e-277 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128694
SMART Domains Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
PDB:4DA5|B 1 150 2e-60 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000135070
SMART Domains Protein: ENSMUSP00000121241
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145791
SMART Domains Protein: ENSMUSP00000122474
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153343
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The major pathway for the biosynthesis of phosphatidylcholine occurs via the CDP-choline pathway. The protein encoded by this gene is the initial enzyme in the sequence and may play a regulatory role. The encoded protein also catalyzes the phosphorylation of ethanolamine. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality between E3.5 and E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 G C 3: 152,504,043 probably null Het
Bbs9 T A 9: 22,567,750 V163E probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
Cbr3 T C 16: 93,683,533 I70T probably damaging Het
Cpq T A 15: 33,213,195 M120K possibly damaging Het
Dcaf1 T A 9: 106,847,874 C520S possibly damaging Het
Egfr T C 11: 16,909,831 Y1018H probably damaging Het
Eif3l T C 15: 79,076,920 Y58H possibly damaging Het
Frmd8 T C 19: 5,865,174 Y234C possibly damaging Het
Fus T C 7: 127,969,826 Y50H unknown Het
Hmcn1 T A 1: 150,694,920 Q2164L probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hsd11b1 T C 1: 193,222,112 K260E probably benign Het
Igkv4-91 C T 6: 68,768,572 G114D probably benign Het
Inpp4b G A 8: 82,041,895 E678K probably damaging Het
Kifc3 G T 8: 95,109,794 P113Q possibly damaging Het
Lgi4 T A 7: 31,060,624 probably null Het
Map1s A G 8: 70,912,519 N107D probably damaging Het
Meiob G T 17: 24,818,328 C60F probably benign Het
Nedd4l G T 18: 64,889,055 probably null Het
Olfr1378 T C 11: 50,969,197 Y60H probably damaging Het
Olfr555 G A 7: 102,659,068 M82I probably damaging Het
Olfr76 C T 19: 12,119,944 C244Y probably damaging Het
Omp A G 7: 98,145,046 F125L probably damaging Het
Pcdha3 T C 18: 36,947,861 V552A probably damaging Het
Plek T C 11: 16,995,276 D18G possibly damaging Het
Ppip5k2 T C 1: 97,747,551 T376A probably damaging Het
Prkdc CAAA CAAAA 16: 15,835,158 3833 probably null Het
Rabgap1 T C 2: 37,542,680 probably null Het
Rtn1 T A 12: 72,223,399 I113F probably damaging Het
Ssu2 T A 6: 112,387,989 D4V probably benign Het
St6galnac2 T C 11: 116,677,548 H363R probably damaging Het
Stk19 T C 17: 34,836,480 S60G possibly damaging Het
Suco G A 1: 161,852,338 T332I probably damaging Het
Trbv20 T A 6: 41,188,958 Y106N probably damaging Het
Uck1 C A 2: 32,260,141 probably benign Het
Vmn1r128 G A 7: 21,349,820 V150I probably benign Het
Vmn2r54 A T 7: 12,616,086 V523E possibly damaging Het
Vmn2r61 A T 7: 42,266,656 E231V probably benign Het
Xkr9 A G 1: 13,701,379 D373G probably benign Het
Zfp592 G C 7: 81,041,523 S1150T possibly damaging Het
Other mutations in Chka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00937:Chka APN 19 3892189 missense probably benign 0.16
IGL02630:Chka APN 19 3892112 missense possibly damaging 0.94
R1432:Chka UTSW 19 3874809 splice site probably benign
R1840:Chka UTSW 19 3886460 missense probably benign 0.00
R1898:Chka UTSW 19 3892205 missense probably damaging 1.00
R3822:Chka UTSW 19 3882038 intron probably benign
R4272:Chka UTSW 19 3875737 splice site probably benign
R4329:Chka UTSW 19 3875803 splice site probably benign
R4573:Chka UTSW 19 3885960 missense probably damaging 1.00
R4720:Chka UTSW 19 3886375 missense probably damaging 0.99
R4923:Chka UTSW 19 3892105 critical splice acceptor site probably null
R5783:Chka UTSW 19 3864661 missense probably damaging 1.00
R5936:Chka UTSW 19 3884580 missense probably benign 0.25
R5979:Chka UTSW 19 3884513 missense probably damaging 1.00
R7429:Chka UTSW 19 3892787 missense probably damaging 1.00
R7430:Chka UTSW 19 3892787 missense probably damaging 1.00
R8189:Chka UTSW 19 3875759 nonsense probably null
R8213:Chka UTSW 19 3885882 missense probably damaging 1.00
R8397:Chka UTSW 19 3852414 critical splice donor site probably null
R9289:Chka UTSW 19 3885953 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGACTCTTTCTTGGGGCAGG -3'
(R):5'- AGTCTGTAGTATCATACACATCGG -3'

Sequencing Primer
(F):5'- GCAGGTTTTCAAGTCAGCAC -3'
(R):5'- CACATCGGTGCTCAGTAGTG -3'
Posted On 2021-01-18