Mutagenetix > Incidental Mutation

Incidental Mutation 'R8348:Axdnd1'

660412

Institutional Source

Beutler Lab

Gene Symbol

Axdnd1

Ensembl Gene

ENSMUSG00000026601

Gene Name

axonemal dynein light chain domain containing 1

Synonyms

LOC381304, 9430070O13Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R8348 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

156323509-156421159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 156418284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 107 (D107E)

Ref Sequence

ENSEMBL: ENSMUSP00000148420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000179744] [ENSMUST00000179985] [ENSMUST00000213088]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000177824
AA Change: D42E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: D42E

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	131	314	2.4e-12	PFAM
low complexity region	405	414	N/A	INTRINSIC
low complexity region	452	464	N/A	INTRINSIC
low complexity region	666	677	N/A	INTRINSIC
coiled coil region	787	837	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000178036
AA Change: D107E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: D107E

Domain	Start	End	E-Value	Type
Pfam:Ax_dynein_light	196	380	3.3e-14	PFAM
low complexity region	470	479	N/A	INTRINSIC
low complexity region	517	529	N/A	INTRINSIC
low complexity region	731	742	N/A	INTRINSIC
coiled coil region	889	939	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179744

Predicted Effect

probably benign
Transcript: ENSMUST00000179985

Predicted Effect

probably benign
Transcript: ENSMUST00000213088
AA Change: D107E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (59/59)

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C10Rik	A	G	7: 38,194,960	Y139C	possibly damaging	Het
A430033K04Rik	A	G	5: 138,636,252	D43G	probably damaging	Het
Actn3	C	A	19: 4,865,333	V464L	possibly damaging	Het
Adamts15	C	T	9: 30,902,550	R773Q	probably benign	Het
Angpt2	G	A	8: 18,741,119	R54*	probably null	Het
Arhgef28	G	T	13: 98,053,867	P195T	possibly damaging	Het
C77080	G	A	4: 129,223,906	R322C	probably damaging	Het
Cdh23	C	T	10: 60,331,728	V1828M	probably benign	Het
Cep95	A	G	11: 106,813,767	T440A	possibly damaging	Het
Ctdp1	G	A	18: 80,450,110	A390V	probably benign	Het
Desi2	T	A	1: 178,256,340		probably benign	Het
Dnah2	A	T	11: 69,429,447	M3932K	possibly damaging	Het
Dnah8	A	T	17: 30,736,147	Q2050L	probably damaging	Het
Etnppl	T	A	3: 130,629,492	M274K	probably benign	Het
Farp2	G	T	1: 93,576,892		probably null	Het
Fbxo46	G	A	7: 19,136,544	G363R	probably damaging	Het
Fiz1	A	G	7: 5,012,910	V27A	probably benign	Het
Fndc3b	T	A	3: 27,439,995	M994L	probably benign	Het
G3bp1	T	G	11: 55,498,631	D384E	possibly damaging	Het
Galnt2	C	T	8: 124,334,286	R306*	probably null	Het
Gle1	T	C	2: 29,942,544	Y304H	possibly damaging	Het
Gm3415	G	A	5: 146,556,597	R84H	probably benign	Het
Gm7694	A	C	1: 170,301,640	S107A	possibly damaging	Het
Gpc6	A	G	14: 117,435,820	D163G	probably damaging	Het
Gtpbp6	G	A	5: 110,104,026	H514Y	possibly damaging	Het
Hdgfl2	A	G	17: 56,099,370	E595G	possibly damaging	Het
Hoxc11	G	A	15: 102,954,751	G76S	possibly damaging	Het
Hoxc4	T	C	15: 103,035,014	C98R	possibly damaging	Het
Hydin	A	T	8: 110,603,246	I4871F	possibly damaging	Het
Ifnar1	A	G	16: 91,495,299	D176G	probably benign	Het
Inafm1	A	G	7: 16,273,130	I54T	probably damaging	Het
Inpp5b	G	A	4: 124,785,174	G458D	probably damaging	Het
Irs2	A	T	8: 11,004,974	S1153T	probably damaging	Het
Kcnj15	A	G	16: 95,295,750	Y77C	probably damaging	Het
Klhl35	C	A	7: 99,471,855	D10E	probably damaging	Het
Lef1	A	T	3: 131,112,812	M1L	probably benign	Het
Lima1	T	C	15: 99,780,872	T403A	probably benign	Het
Magi3	T	A	3: 104,051,215	N518I	probably damaging	Het
Mcoln3	T	C	3: 146,131,219	C269R	probably damaging	Het
Mis18a	A	T	16: 90,727,031	L81*	probably null	Het
Mug2	A	T	6: 122,072,233	K903*	probably null	Het
Pex6	T	C	17: 46,723,113	S656P	probably benign	Het
Pgr	C	A	9: 8,922,601	Q591K	probably benign	Het
Phactr3	T	C	2: 178,256,142	S50P	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Sipa1l1	T	A	12: 82,396,271	N778K	probably benign	Het
Slc22a6	C	G	19: 8,621,805	R267G	probably damaging	Het
Slc5a7	A	G	17: 54,276,627	V545A	possibly damaging	Het
Snf8	A	G	11: 96,035,051	K13R	probably benign	Het
St3gal1	G	A	15: 67,113,662	R48C	probably damaging	Het
Tacc2	A	C	7: 130,623,289	K568T	possibly damaging	Het
Tnxb	C	A	17: 34,710,128	T2715K	possibly damaging	Het
Vegfb	T	C	19: 6,985,488	I140V	probably benign	Het
Vmn2r89	A	C	14: 51,455,091	D117A	possibly damaging	Het
Vps13c	C	T	9: 67,879,103	T284I	possibly damaging	Het
Wnk1	T	C	6: 119,929,999		probably null	Het
Wscd2	T	A	5: 113,572,310	H298Q	possibly damaging	Het
Zfp69	A	T	4: 120,930,637	C494S	probably damaging	Het
Zfp715	T	C	7: 43,299,937	T200A	possibly damaging	Het

Other mutations in Axdnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03058:Axdnd1	APN	1	156376663	missense	probably benign	0.41
IGL03075:Axdnd1	APN	1	156395442	missense	probably damaging	1.00
IGL03165:Axdnd1	APN	1	156378389	missense	probably benign	0.00
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0164:Axdnd1	UTSW	1	156378386	missense	possibly damaging	0.93
R0739:Axdnd1	UTSW	1	156380886	missense	possibly damaging	0.73
R1087:Axdnd1	UTSW	1	156365689	missense	probably benign	0.08
R1350:Axdnd1	UTSW	1	156378380	critical splice donor site	probably null
R1488:Axdnd1	UTSW	1	156348960	missense	probably damaging	1.00
R1493:Axdnd1	UTSW	1	156346701	missense	probably benign	0.03
R1845:Axdnd1	UTSW	1	156376544	missense	possibly damaging	0.58
R1900:Axdnd1	UTSW	1	156380774	splice site	probably null
R2126:Axdnd1	UTSW	1	156333214	missense	probably benign	0.03
R2163:Axdnd1	UTSW	1	156392003	missense	probably damaging	1.00
R2169:Axdnd1	UTSW	1	156418309	missense	probably damaging	1.00
R2380:Axdnd1	UTSW	1	156365651	missense	probably benign	0.02
R2568:Axdnd1	UTSW	1	156392749	missense	possibly damaging	0.90
R3052:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3053:Axdnd1	UTSW	1	156341870	missense	probably damaging	0.96
R3767:Axdnd1	UTSW	1	156380858	missense	probably damaging	1.00
R3927:Axdnd1	UTSW	1	156419270	missense	probably damaging	1.00
R3936:Axdnd1	UTSW	1	156331639	missense	probably benign	0.01
R4829:Axdnd1	UTSW	1	156376646	missense	possibly damaging	0.93
R4882:Axdnd1	UTSW	1	156395559	splice site	probably null
R4969:Axdnd1	UTSW	1	156395505	missense	possibly damaging	0.95
R5091:Axdnd1	UTSW	1	156420410	missense	possibly damaging	0.83
R5510:Axdnd1	UTSW	1	156335350	missense	probably benign	0.03
R5549:Axdnd1	UTSW	1	156398534	missense	probably damaging	1.00
R5587:Axdnd1	UTSW	1	156351412	missense	probably damaging	1.00
R5792:Axdnd1	UTSW	1	156341889	missense	probably damaging	0.99
R5840:Axdnd1	UTSW	1	156348958	missense	probably damaging	1.00
R6187:Axdnd1	UTSW	1	156365612	splice site	probably null
R6208:Axdnd1	UTSW	1	156392856	intron	probably benign
R6369:Axdnd1	UTSW	1	156392745	missense	probably damaging	1.00
R6493:Axdnd1	UTSW	1	156380813	missense	probably damaging	1.00
R7014:Axdnd1	UTSW	1	156330962	splice site	probably null
R7115:Axdnd1	UTSW	1	156380876	missense
R7203:Axdnd1	UTSW	1	156382389	missense	probably damaging	0.98
R7352:Axdnd1	UTSW	1	156382477	missense	possibly damaging	0.91
R7447:Axdnd1	UTSW	1	156418232	critical splice donor site	probably null
R7470:Axdnd1	UTSW	1	156376516	missense
R7686:Axdnd1	UTSW	1	156395464	nonsense	probably null
R7793:Axdnd1	UTSW	1	156338743	critical splice donor site	probably null
R7809:Axdnd1	UTSW	1	156392801	nonsense	probably null
R7882:Axdnd1	UTSW	1	156397453	missense
R8256:Axdnd1	UTSW	1	156330666	missense	unknown
R8971:Axdnd1	UTSW	1	156391946	missense
R9207:Axdnd1	UTSW	1	156388046	missense
R9294:Axdnd1	UTSW	1	156420347	nonsense	probably null
R9741:Axdnd1	UTSW	1	156341815	missense	probably benign	0.18
X0009:Axdnd1	UTSW	1	156388079	missense	possibly damaging	0.61
X0067:Axdnd1	UTSW	1	156376535	missense	possibly damaging	0.67
Z1176:Axdnd1	UTSW	1	156349063	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTAATTCGGAGCACAGCCTC -3'
(R):5'- TTACGCATTCTGCTCCTCTATAAAG -3'

Sequencing Primer
(F):5'- AGAGAACCTCTGGCCTTTTTAC -3'
(R):5'- CTGCTCCTCTATAAAGCATCTAAATG -3'

Posted On

2021-01-18