Incidental Mutation 'R8348:Axdnd1'
ID 660412
Institutional Source Beutler Lab
Gene Symbol Axdnd1
Ensembl Gene ENSMUSG00000026601
Gene Name axonemal dynein light chain domain containing 1
Synonyms 9430070O13Rik, LOC381304
MMRRC Submission 067732-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R8348 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 156157985-156248743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 156245854 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 107 (D107E)
Ref Sequence ENSEMBL: ENSMUSP00000148420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177824] [ENSMUST00000178036] [ENSMUST00000179744] [ENSMUST00000179985] [ENSMUST00000213088]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000177824
AA Change: D42E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000135900
Gene: ENSMUSG00000026601
AA Change: D42E

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 131 314 2.4e-12 PFAM
low complexity region 405 414 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 666 677 N/A INTRINSIC
coiled coil region 787 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178036
AA Change: D107E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000137354
Gene: ENSMUSG00000026601
AA Change: D107E

DomainStartEndE-ValueType
Pfam:Ax_dynein_light 196 380 3.3e-14 PFAM
low complexity region 470 479 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
coiled coil region 889 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179744
Predicted Effect probably benign
Transcript: ENSMUST00000179985
Predicted Effect probably benign
Transcript: ENSMUST00000213088
AA Change: D107E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik A G 7: 37,894,384 (GRCm39) Y139C possibly damaging Het
A430033K04Rik A G 5: 138,634,514 (GRCm39) D43G probably damaging Het
Actn3 C A 19: 4,915,361 (GRCm39) V464L possibly damaging Het
Adamts15 C T 9: 30,813,846 (GRCm39) R773Q probably benign Het
Angpt2 G A 8: 18,791,135 (GRCm39) R54* probably null Het
Arhgef28 G T 13: 98,190,375 (GRCm39) P195T possibly damaging Het
Cdh23 C T 10: 60,167,507 (GRCm39) V1828M probably benign Het
Cep95 A G 11: 106,704,593 (GRCm39) T440A possibly damaging Het
Ctdp1 G A 18: 80,493,325 (GRCm39) A390V probably benign Het
Desi2 T A 1: 178,083,906 (GRCm39) probably benign Het
Dnah2 A T 11: 69,320,273 (GRCm39) M3932K possibly damaging Het
Dnah8 A T 17: 30,955,121 (GRCm39) Q2050L probably damaging Het
Etnppl T A 3: 130,423,141 (GRCm39) M274K probably benign Het
Farp2 G T 1: 93,504,614 (GRCm39) probably null Het
Fbxo46 G A 7: 18,870,469 (GRCm39) G363R probably damaging Het
Fiz1 A G 7: 5,015,909 (GRCm39) V27A probably benign Het
Fndc3b T A 3: 27,494,144 (GRCm39) M994L probably benign Het
G3bp1 T G 11: 55,389,457 (GRCm39) D384E possibly damaging Het
Galnt2 C T 8: 125,061,025 (GRCm39) R306* probably null Het
Gle1 T C 2: 29,832,556 (GRCm39) Y304H possibly damaging Het
Gm3415 G A 5: 146,493,407 (GRCm39) R84H probably benign Het
Gm7694 A C 1: 170,129,209 (GRCm39) S107A possibly damaging Het
Gpc6 A G 14: 117,673,232 (GRCm39) D163G probably damaging Het
Gtpbp6 G A 5: 110,251,892 (GRCm39) H514Y possibly damaging Het
Hdgfl2 A G 17: 56,406,370 (GRCm39) E595G possibly damaging Het
Hoxc11 G A 15: 102,863,186 (GRCm39) G76S possibly damaging Het
Hoxc4 T C 15: 102,943,440 (GRCm39) C98R possibly damaging Het
Hydin A T 8: 111,329,878 (GRCm39) I4871F possibly damaging Het
Ifnar1 A G 16: 91,292,187 (GRCm39) D176G probably benign Het
Inafm1 A G 7: 16,007,055 (GRCm39) I54T probably damaging Het
Inpp5b G A 4: 124,678,967 (GRCm39) G458D probably damaging Het
Irs2 A T 8: 11,054,974 (GRCm39) S1153T probably damaging Het
Kcnj15 A G 16: 95,096,609 (GRCm39) Y77C probably damaging Het
Klhl35 C A 7: 99,121,062 (GRCm39) D10E probably damaging Het
Lef1 A T 3: 130,906,461 (GRCm39) M1L probably benign Het
Lima1 T C 15: 99,678,753 (GRCm39) T403A probably benign Het
Magi3 T A 3: 103,958,531 (GRCm39) N518I probably damaging Het
Mcoln3 T C 3: 145,836,974 (GRCm39) C269R probably damaging Het
Mis18a A T 16: 90,523,919 (GRCm39) L81* probably null Het
Mug2 A T 6: 122,049,192 (GRCm39) K903* probably null Het
Nhsl3 G A 4: 129,117,699 (GRCm39) R322C probably damaging Het
Pex6 T C 17: 47,034,039 (GRCm39) S656P probably benign Het
Pgr C A 9: 8,922,602 (GRCm39) Q591K probably benign Het
Phactr3 T C 2: 177,897,935 (GRCm39) S50P probably benign Het
Plscr4 C T 9: 92,372,843 (GRCm39) R322* probably null Het
Sipa1l1 T A 12: 82,443,045 (GRCm39) N778K probably benign Het
Slc22a6 C G 19: 8,599,169 (GRCm39) R267G probably damaging Het
Slc5a7 A G 17: 54,583,655 (GRCm39) V545A possibly damaging Het
Snf8 A G 11: 95,925,877 (GRCm39) K13R probably benign Het
St3gal1 G A 15: 66,985,511 (GRCm39) R48C probably damaging Het
Tacc2 A C 7: 130,225,019 (GRCm39) K568T possibly damaging Het
Tnxb C A 17: 34,929,102 (GRCm39) T2715K possibly damaging Het
Vegfb T C 19: 6,962,856 (GRCm39) I140V probably benign Het
Vmn2r89 A C 14: 51,692,548 (GRCm39) D117A possibly damaging Het
Vps13c C T 9: 67,786,385 (GRCm39) T284I possibly damaging Het
Wnk1 T C 6: 119,906,960 (GRCm39) probably null Het
Wscd2 T A 5: 113,710,371 (GRCm39) H298Q possibly damaging Het
Zfp69 A T 4: 120,787,834 (GRCm39) C494S probably damaging Het
Zfp715 T C 7: 42,949,361 (GRCm39) T200A possibly damaging Het
Other mutations in Axdnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03058:Axdnd1 APN 1 156,204,233 (GRCm39) missense probably benign 0.41
IGL03075:Axdnd1 APN 1 156,223,012 (GRCm39) missense probably damaging 1.00
IGL03165:Axdnd1 APN 1 156,205,959 (GRCm39) missense probably benign 0.00
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0164:Axdnd1 UTSW 1 156,205,956 (GRCm39) missense possibly damaging 0.93
R0739:Axdnd1 UTSW 1 156,208,456 (GRCm39) missense possibly damaging 0.73
R1087:Axdnd1 UTSW 1 156,193,259 (GRCm39) missense probably benign 0.08
R1350:Axdnd1 UTSW 1 156,205,950 (GRCm39) critical splice donor site probably null
R1488:Axdnd1 UTSW 1 156,176,530 (GRCm39) missense probably damaging 1.00
R1493:Axdnd1 UTSW 1 156,174,271 (GRCm39) missense probably benign 0.03
R1845:Axdnd1 UTSW 1 156,204,114 (GRCm39) missense possibly damaging 0.58
R1900:Axdnd1 UTSW 1 156,208,344 (GRCm39) splice site probably null
R2126:Axdnd1 UTSW 1 156,160,784 (GRCm39) missense probably benign 0.03
R2163:Axdnd1 UTSW 1 156,219,573 (GRCm39) missense probably damaging 1.00
R2169:Axdnd1 UTSW 1 156,245,879 (GRCm39) missense probably damaging 1.00
R2380:Axdnd1 UTSW 1 156,193,221 (GRCm39) missense probably benign 0.02
R2568:Axdnd1 UTSW 1 156,220,319 (GRCm39) missense possibly damaging 0.90
R3052:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3053:Axdnd1 UTSW 1 156,169,440 (GRCm39) missense probably damaging 0.96
R3767:Axdnd1 UTSW 1 156,208,428 (GRCm39) missense probably damaging 1.00
R3927:Axdnd1 UTSW 1 156,246,840 (GRCm39) missense probably damaging 1.00
R3936:Axdnd1 UTSW 1 156,159,209 (GRCm39) missense probably benign 0.01
R4829:Axdnd1 UTSW 1 156,204,216 (GRCm39) missense possibly damaging 0.93
R4882:Axdnd1 UTSW 1 156,223,129 (GRCm39) splice site probably null
R4969:Axdnd1 UTSW 1 156,223,075 (GRCm39) missense possibly damaging 0.95
R5091:Axdnd1 UTSW 1 156,247,980 (GRCm39) missense possibly damaging 0.83
R5510:Axdnd1 UTSW 1 156,162,920 (GRCm39) missense probably benign 0.03
R5549:Axdnd1 UTSW 1 156,226,104 (GRCm39) missense probably damaging 1.00
R5587:Axdnd1 UTSW 1 156,178,982 (GRCm39) missense probably damaging 1.00
R5792:Axdnd1 UTSW 1 156,169,459 (GRCm39) missense probably damaging 0.99
R5840:Axdnd1 UTSW 1 156,176,528 (GRCm39) missense probably damaging 1.00
R6187:Axdnd1 UTSW 1 156,193,182 (GRCm39) splice site probably null
R6208:Axdnd1 UTSW 1 156,220,426 (GRCm39) intron probably benign
R6369:Axdnd1 UTSW 1 156,220,315 (GRCm39) missense probably damaging 1.00
R6493:Axdnd1 UTSW 1 156,208,383 (GRCm39) missense probably damaging 1.00
R7014:Axdnd1 UTSW 1 156,158,532 (GRCm39) splice site probably null
R7115:Axdnd1 UTSW 1 156,208,446 (GRCm39) missense
R7203:Axdnd1 UTSW 1 156,209,959 (GRCm39) missense probably damaging 0.98
R7352:Axdnd1 UTSW 1 156,210,047 (GRCm39) missense possibly damaging 0.91
R7447:Axdnd1 UTSW 1 156,245,802 (GRCm39) critical splice donor site probably null
R7470:Axdnd1 UTSW 1 156,204,086 (GRCm39) missense
R7686:Axdnd1 UTSW 1 156,223,034 (GRCm39) nonsense probably null
R7793:Axdnd1 UTSW 1 156,166,313 (GRCm39) critical splice donor site probably null
R7809:Axdnd1 UTSW 1 156,220,371 (GRCm39) nonsense probably null
R7882:Axdnd1 UTSW 1 156,225,023 (GRCm39) missense
R8256:Axdnd1 UTSW 1 156,158,236 (GRCm39) missense unknown
R8971:Axdnd1 UTSW 1 156,219,516 (GRCm39) missense
R9207:Axdnd1 UTSW 1 156,215,616 (GRCm39) missense
R9294:Axdnd1 UTSW 1 156,247,917 (GRCm39) nonsense probably null
R9741:Axdnd1 UTSW 1 156,169,385 (GRCm39) missense probably benign 0.18
X0009:Axdnd1 UTSW 1 156,215,649 (GRCm39) missense possibly damaging 0.61
X0067:Axdnd1 UTSW 1 156,204,105 (GRCm39) missense possibly damaging 0.67
Z1176:Axdnd1 UTSW 1 156,176,633 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAATTCGGAGCACAGCCTC -3'
(R):5'- TTACGCATTCTGCTCCTCTATAAAG -3'

Sequencing Primer
(F):5'- AGAGAACCTCTGGCCTTTTTAC -3'
(R):5'- CTGCTCCTCTATAAAGCATCTAAATG -3'
Posted On 2021-01-18