Incidental Mutation 'R8348:Mug2'
ID 660429
Institutional Source Beutler Lab
Gene Symbol Mug2
Ensembl Gene ENSMUSG00000030131
Gene Name murinoglobulin 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8348 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 122006761-122085965 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 122072233 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 903 (K903*)
Ref Sequence ENSEMBL: ENSMUSP00000080469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081777]
AlphaFold P28666
Predicted Effect probably null
Transcript: ENSMUST00000081777
AA Change: K903*
SMART Domains Protein: ENSMUSP00000080469
Gene: ENSMUSG00000030131
AA Change: K903*

DomainStartEndE-ValueType
Pfam:A2M_N 128 221 3.5e-21 PFAM
A2M_N_2 449 599 1.05e-42 SMART
low complexity region 711 728 N/A INTRINSIC
A2M 740 830 7.16e-36 SMART
Pfam:Thiol-ester_cl 963 992 1e-18 PFAM
low complexity region 994 1005 N/A INTRINSIC
Pfam:A2M_comp 1012 1097 5.8e-34 PFAM
Pfam:A2M_comp 1093 1243 3e-47 PFAM
A2M_recep 1353 1440 1.85e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik A G 7: 38,194,960 Y139C possibly damaging Het
A430033K04Rik A G 5: 138,636,252 D43G probably damaging Het
Actn3 C A 19: 4,865,333 V464L possibly damaging Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Arhgef28 G T 13: 98,053,867 P195T possibly damaging Het
Axdnd1 A T 1: 156,418,284 D107E probably benign Het
C77080 G A 4: 129,223,906 R322C probably damaging Het
Cdh23 C T 10: 60,331,728 V1828M probably benign Het
Cep95 A G 11: 106,813,767 T440A possibly damaging Het
Ctdp1 G A 18: 80,450,110 A390V probably benign Het
Desi2 T A 1: 178,256,340 probably benign Het
Dnah2 A T 11: 69,429,447 M3932K possibly damaging Het
Dnah8 A T 17: 30,736,147 Q2050L probably damaging Het
Etnppl T A 3: 130,629,492 M274K probably benign Het
Farp2 G T 1: 93,576,892 probably null Het
Fbxo46 G A 7: 19,136,544 G363R probably damaging Het
Fiz1 A G 7: 5,012,910 V27A probably benign Het
Fndc3b T A 3: 27,439,995 M994L probably benign Het
G3bp1 T G 11: 55,498,631 D384E possibly damaging Het
Galnt2 C T 8: 124,334,286 R306* probably null Het
Gle1 T C 2: 29,942,544 Y304H possibly damaging Het
Gm3415 G A 5: 146,556,597 R84H probably benign Het
Gm7694 A C 1: 170,301,640 S107A possibly damaging Het
Gpc6 A G 14: 117,435,820 D163G probably damaging Het
Gtpbp6 G A 5: 110,104,026 H514Y possibly damaging Het
Hdgfl2 A G 17: 56,099,370 E595G possibly damaging Het
Hoxc11 G A 15: 102,954,751 G76S possibly damaging Het
Hoxc4 T C 15: 103,035,014 C98R possibly damaging Het
Hydin A T 8: 110,603,246 I4871F possibly damaging Het
Ifnar1 A G 16: 91,495,299 D176G probably benign Het
Inafm1 A G 7: 16,273,130 I54T probably damaging Het
Inpp5b G A 4: 124,785,174 G458D probably damaging Het
Irs2 A T 8: 11,004,974 S1153T probably damaging Het
Kcnj15 A G 16: 95,295,750 Y77C probably damaging Het
Klhl35 C A 7: 99,471,855 D10E probably damaging Het
Lef1 A T 3: 131,112,812 M1L probably benign Het
Lima1 T C 15: 99,780,872 T403A probably benign Het
Magi3 T A 3: 104,051,215 N518I probably damaging Het
Mcoln3 T C 3: 146,131,219 C269R probably damaging Het
Mis18a A T 16: 90,727,031 L81* probably null Het
Pex6 T C 17: 46,723,113 S656P probably benign Het
Pgr C A 9: 8,922,601 Q591K probably benign Het
Phactr3 T C 2: 178,256,142 S50P probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Sipa1l1 T A 12: 82,396,271 N778K probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slc5a7 A G 17: 54,276,627 V545A possibly damaging Het
Snf8 A G 11: 96,035,051 K13R probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Tacc2 A C 7: 130,623,289 K568T possibly damaging Het
Tnxb C A 17: 34,710,128 T2715K possibly damaging Het
Vegfb T C 19: 6,985,488 I140V probably benign Het
Vmn2r89 A C 14: 51,455,091 D117A possibly damaging Het
Vps13c C T 9: 67,879,103 T284I possibly damaging Het
Wnk1 T C 6: 119,929,999 probably null Het
Wscd2 T A 5: 113,572,310 H298Q possibly damaging Het
Zfp69 A T 4: 120,930,637 C494S probably damaging Het
Zfp715 T C 7: 43,299,937 T200A possibly damaging Het
Other mutations in Mug2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Mug2 APN 6 122047487 missense possibly damaging 0.83
IGL00957:Mug2 APN 6 122040654 missense probably damaging 0.99
IGL01314:Mug2 APN 6 122081279 missense possibly damaging 0.62
IGL01338:Mug2 APN 6 122049628 splice site probably benign
IGL01477:Mug2 APN 6 122081684 splice site probably benign
IGL01926:Mug2 APN 6 122036104 splice site probably benign
IGL02019:Mug2 APN 6 122047435 missense probably benign 0.02
IGL02305:Mug2 APN 6 122036056 missense probably benign
IGL02310:Mug2 APN 6 122059123 splice site probably benign
IGL02484:Mug2 APN 6 122072753 missense probably damaging 1.00
IGL02516:Mug2 APN 6 122070843 missense probably damaging 1.00
IGL02531:Mug2 APN 6 122072771 missense probably damaging 1.00
IGL02666:Mug2 APN 6 122081326 missense probably damaging 1.00
IGL02936:Mug2 APN 6 122081387 critical splice donor site probably null
R0114:Mug2 UTSW 6 122040648 missense probably damaging 1.00
R0119:Mug2 UTSW 6 122036063 missense probably benign 0.00
R0123:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0144:Mug2 UTSW 6 122071011 splice site probably benign
R0225:Mug2 UTSW 6 122074714 missense possibly damaging 0.89
R0514:Mug2 UTSW 6 122081599 missense probably damaging 1.00
R0763:Mug2 UTSW 6 122075294 missense probably benign
R0959:Mug2 UTSW 6 122085495 missense probably benign 0.33
R1104:Mug2 UTSW 6 122059055 missense probably benign
R1239:Mug2 UTSW 6 122081678 splice site probably benign
R1318:Mug2 UTSW 6 122077402 missense probably damaging 1.00
R1460:Mug2 UTSW 6 122040533 splice site probably benign
R1706:Mug2 UTSW 6 122036232 splice site probably benign
R1761:Mug2 UTSW 6 122074705 missense probably benign 0.20
R1901:Mug2 UTSW 6 122071842 missense probably benign 0.02
R1913:Mug2 UTSW 6 122070870 missense probably damaging 1.00
R1943:Mug2 UTSW 6 122079639 missense probably benign
R2054:Mug2 UTSW 6 122077492 missense probably damaging 1.00
R2060:Mug2 UTSW 6 122079612 missense probably benign
R2420:Mug2 UTSW 6 122083460 missense probably damaging 1.00
R2432:Mug2 UTSW 6 122084376 missense possibly damaging 0.93
R2916:Mug2 UTSW 6 122074724 splice site probably null
R2918:Mug2 UTSW 6 122074724 splice site probably null
R3423:Mug2 UTSW 6 122047506 splice site probably benign
R3834:Mug2 UTSW 6 122049787 critical splice donor site probably null
R3902:Mug2 UTSW 6 122075567 missense probably damaging 1.00
R3941:Mug2 UTSW 6 122063563 missense probably benign
R4227:Mug2 UTSW 6 122040732 missense probably benign 0.10
R4284:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4287:Mug2 UTSW 6 122063673 missense probably benign 0.00
R4377:Mug2 UTSW 6 122071007 critical splice donor site probably null
R4419:Mug2 UTSW 6 122079630 missense probably damaging 1.00
R4498:Mug2 UTSW 6 122082752 missense probably damaging 0.99
R4566:Mug2 UTSW 6 122079638 missense probably benign 0.00
R4690:Mug2 UTSW 6 122036296 missense probably benign
R4732:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4733:Mug2 UTSW 6 122071872 missense probably damaging 0.99
R4741:Mug2 UTSW 6 122079613 missense probably benign
R4888:Mug2 UTSW 6 122081195 missense probably damaging 1.00
R5199:Mug2 UTSW 6 122040660 missense probably benign
R5347:Mug2 UTSW 6 122081592 missense probably damaging 1.00
R5457:Mug2 UTSW 6 122049729 nonsense probably null
R5495:Mug2 UTSW 6 122079650 missense probably damaging 0.96
R5509:Mug2 UTSW 6 122084381 missense possibly damaging 0.84
R6006:Mug2 UTSW 6 122083500 missense probably null 0.98
R6180:Mug2 UTSW 6 122079606 missense probably benign 0.01
R6184:Mug2 UTSW 6 122037046 missense probably benign
R6199:Mug2 UTSW 6 122047439 missense probably benign 0.05
R6262:Mug2 UTSW 6 122075255 missense probably damaging 1.00
R6416:Mug2 UTSW 6 122082754 missense probably damaging 1.00
R6548:Mug2 UTSW 6 122047442 missense probably damaging 1.00
R6703:Mug2 UTSW 6 122078694 missense probably benign 0.25
R7106:Mug2 UTSW 6 122082721 missense probably damaging 1.00
R7131:Mug2 UTSW 6 122075247 missense probably damaging 1.00
R7372:Mug2 UTSW 6 122083466 missense possibly damaging 0.88
R7379:Mug2 UTSW 6 122047487 missense possibly damaging 0.83
R7419:Mug2 UTSW 6 122040570 missense possibly damaging 0.86
R7423:Mug2 UTSW 6 122079726 missense probably benign 0.00
R7581:Mug2 UTSW 6 122063711 missense probably damaging 1.00
R7582:Mug2 UTSW 6 122079644 missense probably damaging 0.99
R7672:Mug2 UTSW 6 122040719 missense probably benign 0.37
R7713:Mug2 UTSW 6 122078795 missense possibly damaging 0.83
R7759:Mug2 UTSW 6 122081358 missense probably damaging 1.00
R7834:Mug2 UTSW 6 122036282 missense probably benign
R7850:Mug2 UTSW 6 122075211 missense probably damaging 1.00
R8029:Mug2 UTSW 6 122081545 critical splice acceptor site probably null
R8127:Mug2 UTSW 6 122075608 missense probably benign 0.01
R8335:Mug2 UTSW 6 122040584 missense probably benign
R8557:Mug2 UTSW 6 122063701 missense probably damaging 0.99
R8798:Mug2 UTSW 6 122081610 missense probably damaging 1.00
R8823:Mug2 UTSW 6 122063689 missense possibly damaging 0.89
R9029:Mug2 UTSW 6 122084369 missense probably damaging 1.00
R9153:Mug2 UTSW 6 122040668 missense possibly damaging 0.71
R9185:Mug2 UTSW 6 122077483 missense probably benign 0.06
R9186:Mug2 UTSW 6 122075289 missense probably damaging 0.99
R9418:Mug2 UTSW 6 122040741 missense probably benign 0.00
R9464:Mug2 UTSW 6 122051731 missense probably benign 0.01
R9622:Mug2 UTSW 6 122051792 missense probably benign 0.29
Z1177:Mug2 UTSW 6 122037121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTAGAACCAAGGAGGCAC -3'
(R):5'- GCTTCAGTTAAAAGCCTAGGAATG -3'

Sequencing Primer
(F):5'- CACTGCAGATCTAGGGGCTTTG -3'
(R):5'- GGAAAAGAAAGCACAACACATATCTG -3'
Posted On 2021-01-18