Incidental Mutation 'R8348:Galnt2'
ID660440
Institutional Source Beutler Lab
Gene Symbol Galnt2
Ensembl Gene ENSMUSG00000089704
Gene Namepolypeptide N-acetylgalactosaminyltransferase 2
SynonymsppGaNTase-T2
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_139272.2; MGI:894694

Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R8348 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location124231391-124345724 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 124334286 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 306 (R306*)
Ref Sequence ENSEMBL: ENSMUSP00000118564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034458] [ENSMUST00000127664]
Predicted Effect probably null
Transcript: ENSMUST00000034458
AA Change: R340*
SMART Domains Protein: ENSMUSP00000034458
Gene: ENSMUSG00000089704
AA Change: R340*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 25 39 N/A INTRINSIC
Pfam:Glycos_transf_2 138 321 8.3e-31 PFAM
Pfam:Glyco_transf_7C 295 365 5.4e-8 PFAM
RICIN 440 565 9.28e-27 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127664
AA Change: R306*
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329
AA Change: R306*

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 2 protein family. Members of this family initiate mucin-type O-glycoslation of peptides in the Golgi apparatus. The encoded protein may be involved in O-linked glycosylation of the immunoglobulin A1 hinge region. This gene may influence triglyceride levels, and may be involved Type 2 diabetes, as well as several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI

None

Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C10Rik A G 7: 38,194,960 Y139C possibly damaging Het
A430033K04Rik A G 5: 138,636,252 D43G probably damaging Het
Actn3 C A 19: 4,865,333 V464L possibly damaging Het
Adamts15 C T 9: 30,902,550 R773Q probably benign Het
Angpt2 G A 8: 18,741,119 R54* probably null Het
Arhgef28 G T 13: 98,053,867 P195T possibly damaging Het
Axdnd1 A T 1: 156,418,284 D107E probably benign Het
C77080 G A 4: 129,223,906 R322C probably damaging Het
Cdh23 C T 10: 60,331,728 V1828M probably benign Het
Cep95 A G 11: 106,813,767 T440A possibly damaging Het
Ctdp1 G A 18: 80,450,110 A390V probably benign Het
Desi2 T A 1: 178,256,340 probably benign Het
Dnah2 A T 11: 69,429,447 M3932K possibly damaging Het
Dnah8 A T 17: 30,736,147 Q2050L probably damaging Het
Etnppl T A 3: 130,629,492 M274K probably benign Het
Farp2 G T 1: 93,576,892 probably null Het
Fbxo46 G A 7: 19,136,544 G363R probably damaging Het
Fiz1 A G 7: 5,012,910 V27A probably benign Het
Fndc3b T A 3: 27,439,995 M994L probably benign Het
G3bp1 T G 11: 55,498,631 D384E possibly damaging Het
Gle1 T C 2: 29,942,544 Y304H possibly damaging Het
Gm3415 G A 5: 146,556,597 R84H probably benign Het
Gm7694 A C 1: 170,301,640 S107A possibly damaging Het
Gpc6 A G 14: 117,435,820 D163G probably damaging Het
Gtpbp6 G A 5: 110,104,026 H514Y possibly damaging Het
Hdgfl2 A G 17: 56,099,370 E595G possibly damaging Het
Hoxc11 G A 15: 102,954,751 G76S possibly damaging Het
Hoxc4 T C 15: 103,035,014 C98R possibly damaging Het
Hydin A T 8: 110,603,246 I4871F possibly damaging Het
Ifnar1 A G 16: 91,495,299 D176G probably benign Het
Inafm1 A G 7: 16,273,130 I54T probably damaging Het
Inpp5b G A 4: 124,785,174 G458D probably damaging Het
Irs2 A T 8: 11,004,974 S1153T probably damaging Het
Kcnj15 A G 16: 95,295,750 Y77C probably damaging Het
Klhl35 C A 7: 99,471,855 D10E probably damaging Het
Lef1 A T 3: 131,112,812 M1L probably benign Het
Lima1 T C 15: 99,780,872 T403A probably benign Het
Magi3 T A 3: 104,051,215 N518I probably damaging Het
Mcoln3 T C 3: 146,131,219 C269R probably damaging Het
Mis18a A T 16: 90,727,031 L81* probably null Het
Mug2 A T 6: 122,072,233 K903* probably null Het
Pex6 T C 17: 46,723,113 S656P probably benign Het
Pgr C A 9: 8,922,601 Q591K probably benign Het
Phactr3 T C 2: 178,256,142 S50P probably benign Het
Plscr4 C T 9: 92,490,790 R322* probably null Het
Sipa1l1 T A 12: 82,396,271 N778K probably benign Het
Slc22a6 C G 19: 8,621,805 R267G probably damaging Het
Slc5a7 A G 17: 54,276,627 V545A possibly damaging Het
Snf8 A G 11: 96,035,051 K13R probably benign Het
St3gal1 G A 15: 67,113,662 R48C probably damaging Het
Tacc2 A C 7: 130,623,289 K568T possibly damaging Het
Tnxb C A 17: 34,710,128 T2715K possibly damaging Het
Vegfb T C 19: 6,985,488 I140V probably benign Het
Vmn2r89 A C 14: 51,455,091 D117A possibly damaging Het
Vps13c C T 9: 67,879,103 T284I possibly damaging Het
Wnk1 T C 6: 119,929,999 probably null Het
Wscd2 T A 5: 113,572,310 H298Q possibly damaging Het
Zfp69 A T 4: 120,930,637 C494S probably damaging Het
Zfp715 T C 7: 43,299,937 T200A possibly damaging Het
Other mutations in Galnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02187:Galnt2 APN 8 124305506 splice site probably benign
IGL02638:Galnt2 APN 8 124231579 missense probably damaging 0.98
chivalry UTSW 8 124334286 nonsense probably null
gallantry UTSW 8 124340822 missense probably damaging 1.00
valor UTSW 8 124329788 missense probably damaging 1.00
P0018:Galnt2 UTSW 8 124336611 missense probably damaging 1.00
R0133:Galnt2 UTSW 8 124338538 missense probably benign 0.19
R0453:Galnt2 UTSW 8 124338584 splice site probably benign
R0709:Galnt2 UTSW 8 124343346 missense probably benign 0.01
R1015:Galnt2 UTSW 8 124336617 missense probably benign
R4388:Galnt2 UTSW 8 124295453 critical splice donor site probably null
R4400:Galnt2 UTSW 8 124324303 missense probably damaging 1.00
R4447:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4448:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4449:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4450:Galnt2 UTSW 8 124295377 missense probably benign 0.04
R4927:Galnt2 UTSW 8 124305623 missense probably damaging 1.00
R5536:Galnt2 UTSW 8 124323673 missense probably damaging 1.00
R6218:Galnt2 UTSW 8 124343315 missense probably benign 0.01
R6732:Galnt2 UTSW 8 124340822 missense probably damaging 1.00
R6795:Galnt2 UTSW 8 124343436 missense probably damaging 1.00
R6823:Galnt2 UTSW 8 124324011 missense probably benign
R7173:Galnt2 UTSW 8 124305553 missense probably benign 0.00
R7479:Galnt2 UTSW 8 124334338 missense probably damaging 1.00
R7818:Galnt2 UTSW 8 124329788 missense probably damaging 1.00
R7821:Galnt2 UTSW 8 124343395 missense possibly damaging 0.51
R7831:Galnt2 UTSW 8 124332078 missense probably benign 0.04
R8770:Galnt2 UTSW 8 124334286 nonsense probably null
R8826:Galnt2 UTSW 8 124305608 missense probably damaging 1.00
X0024:Galnt2 UTSW 8 124343345 missense probably benign 0.28
Z1177:Galnt2 UTSW 8 124343318 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- ACAGAGCTTTCCATGCGTG -3'
(R):5'- TACCAGGGTCTTCTGAGCAGAC -3'

Sequencing Primer
(F):5'- TGTCCATGATGCCCCAGTG -3'
(R):5'- ACAGCAGACATCTGGGCTG -3'
Posted On2021-01-18