Mutagenetix > Incidental Mutation

Incidental Mutation 'R8348:G3bp1'

660446

Institutional Source

Beutler Lab

Gene Symbol

G3bp1

Ensembl Gene

ENSMUSG00000018583

Gene Name

GTPase activating protein (SH3 domain) binding protein 1

Synonyms

GAP SH3 binding protein

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8348 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55469685-55504838 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 55498631 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 384 (D384E)

Ref Sequence

ENSEMBL: ENSMUSP00000018727 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018727]

AlphaFold

P97855

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018727
AA Change: D384E

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000018727
Gene: ENSMUSG00000018583
AA Change: D384E

Domain	Start	End	E-Value	Type
Pfam:NTF2	11	133	5.8e-35	PFAM
low complexity region	142	167	N/A	INTRINSIC
low complexity region	187	206	N/A	INTRINSIC
low complexity region	211	225	N/A	INTRINSIC
low complexity region	289	305	N/A	INTRINSIC
RRM	339	409	1.49e-13	SMART
low complexity region	419	447	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the DNA-unwinding enzymes which prefers partially unwound 3'-tailed substrates and can also unwind partial RNA/DNA and RNA/RNA duplexes in an ATP-dependent fashion. This enzyme is a member of the heterogeneous nuclear RNA-binding proteins and is also an element of the Ras signal transduction pathway. It binds specifically to the Ras-GTPase-activating protein by associating with its SH3 domain. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display perinatal lethality with severe cell death in the nervous system and decreased cell proliferation. Neonates from heterozygous null female mice display increased mortality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C10Rik	A	G	7: 38,194,960	Y139C	possibly damaging	Het
A430033K04Rik	A	G	5: 138,636,252	D43G	probably damaging	Het
Actn3	C	A	19: 4,865,333	V464L	possibly damaging	Het
Adamts15	C	T	9: 30,902,550	R773Q	probably benign	Het
Angpt2	G	A	8: 18,741,119	R54*	probably null	Het
Arhgef28	G	T	13: 98,053,867	P195T	possibly damaging	Het
Axdnd1	A	T	1: 156,418,284	D107E	probably benign	Het
C77080	G	A	4: 129,223,906	R322C	probably damaging	Het
Cdh23	C	T	10: 60,331,728	V1828M	probably benign	Het
Cep95	A	G	11: 106,813,767	T440A	possibly damaging	Het
Ctdp1	G	A	18: 80,450,110	A390V	probably benign	Het
Desi2	T	A	1: 178,256,340		probably benign	Het
Dnah2	A	T	11: 69,429,447	M3932K	possibly damaging	Het
Dnah8	A	T	17: 30,736,147	Q2050L	probably damaging	Het
Etnppl	T	A	3: 130,629,492	M274K	probably benign	Het
Farp2	G	T	1: 93,576,892		probably null	Het
Fbxo46	G	A	7: 19,136,544	G363R	probably damaging	Het
Fiz1	A	G	7: 5,012,910	V27A	probably benign	Het
Fndc3b	T	A	3: 27,439,995	M994L	probably benign	Het
Galnt2	C	T	8: 124,334,286	R306*	probably null	Het
Gle1	T	C	2: 29,942,544	Y304H	possibly damaging	Het
Gm3415	G	A	5: 146,556,597	R84H	probably benign	Het
Gm7694	A	C	1: 170,301,640	S107A	possibly damaging	Het
Gpc6	A	G	14: 117,435,820	D163G	probably damaging	Het
Gtpbp6	G	A	5: 110,104,026	H514Y	possibly damaging	Het
Hdgfl2	A	G	17: 56,099,370	E595G	possibly damaging	Het
Hoxc11	G	A	15: 102,954,751	G76S	possibly damaging	Het
Hoxc4	T	C	15: 103,035,014	C98R	possibly damaging	Het
Hydin	A	T	8: 110,603,246	I4871F	possibly damaging	Het
Ifnar1	A	G	16: 91,495,299	D176G	probably benign	Het
Inafm1	A	G	7: 16,273,130	I54T	probably damaging	Het
Inpp5b	G	A	4: 124,785,174	G458D	probably damaging	Het
Irs2	A	T	8: 11,004,974	S1153T	probably damaging	Het
Kcnj15	A	G	16: 95,295,750	Y77C	probably damaging	Het
Klhl35	C	A	7: 99,471,855	D10E	probably damaging	Het
Lef1	A	T	3: 131,112,812	M1L	probably benign	Het
Lima1	T	C	15: 99,780,872	T403A	probably benign	Het
Magi3	T	A	3: 104,051,215	N518I	probably damaging	Het
Mcoln3	T	C	3: 146,131,219	C269R	probably damaging	Het
Mis18a	A	T	16: 90,727,031	L81*	probably null	Het
Mug2	A	T	6: 122,072,233	K903*	probably null	Het
Pex6	T	C	17: 46,723,113	S656P	probably benign	Het
Pgr	C	A	9: 8,922,601	Q591K	probably benign	Het
Phactr3	T	C	2: 178,256,142	S50P	probably benign	Het
Plscr4	C	T	9: 92,490,790	R322*	probably null	Het
Sipa1l1	T	A	12: 82,396,271	N778K	probably benign	Het
Slc22a6	C	G	19: 8,621,805	R267G	probably damaging	Het
Slc5a7	A	G	17: 54,276,627	V545A	possibly damaging	Het
Snf8	A	G	11: 96,035,051	K13R	probably benign	Het
St3gal1	G	A	15: 67,113,662	R48C	probably damaging	Het
Tacc2	A	C	7: 130,623,289	K568T	possibly damaging	Het
Tnxb	C	A	17: 34,710,128	T2715K	possibly damaging	Het
Vegfb	T	C	19: 6,985,488	I140V	probably benign	Het
Vmn2r89	A	C	14: 51,455,091	D117A	possibly damaging	Het
Vps13c	C	T	9: 67,879,103	T284I	possibly damaging	Het
Wnk1	T	C	6: 119,929,999		probably null	Het
Wscd2	T	A	5: 113,572,310	H298Q	possibly damaging	Het
Zfp69	A	T	4: 120,930,637	C494S	probably damaging	Het
Zfp715	T	C	7: 43,299,937	T200A	possibly damaging	Het

Other mutations in G3bp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02231:G3bp1	APN	11	55495447	nonsense	probably null
silverheels	UTSW	11	55489116	missense	possibly damaging	0.95
R0056:G3bp1	UTSW	11	55498041	missense	probably benign	0.03
R0113:G3bp1	UTSW	11	55495426	missense	probably benign	0.00
R0240:G3bp1	UTSW	11	55492028	missense	probably damaging	1.00
R0240:G3bp1	UTSW	11	55492028	missense	probably damaging	1.00
R0311:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0312:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0367:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0368:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0454:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0464:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0465:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0466:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0467:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0486:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0487:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0533:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0551:G3bp1	UTSW	11	55489143	missense	probably benign	0.01
R0689:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R0848:G3bp1	UTSW	11	55498626	missense	probably damaging	1.00
R2109:G3bp1	UTSW	11	55489160	missense	probably damaging	0.97
R5129:G3bp1	UTSW	11	55489116	missense	possibly damaging	0.95
R5439:G3bp1	UTSW	11	55497987	missense	probably damaging	0.96
R5834:G3bp1	UTSW	11	55497940	missense	probably benign
R6692:G3bp1	UTSW	11	55493509	missense	probably benign	0.00
R6925:G3bp1	UTSW	11	55497960	missense	possibly damaging	0.47
R7091:G3bp1	UTSW	11	55496221	missense	possibly damaging	0.94
R9375:G3bp1	UTSW	11	55499613	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGCCTTGCCCACTTGGATC -3'
(R):5'- TCACAACTTCTGGGAGGTGG -3'

Sequencing Primer
(F):5'- CCCCACAGCTTTAAGAATTTATGATC -3'
(R):5'- TAACTCCATGTCCAGGGCATG -3'

Posted On

2021-01-18