Mutagenetix > Incidental Mutation

Incidental Mutation 'R8351:Rptor'

660499

Institutional Source

Beutler Lab

Gene Symbol

Rptor

Ensembl Gene

ENSMUSG00000025583

Gene Name

regulatory associated protein of MTOR, complex 1

Synonyms

Rap, raptor, 4932417H02Rik

MMRRC Submission

067804-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8351 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119493731-119790402 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119783465 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1153 (D1153G)

Ref Sequence

ENSEMBL: ENSMUSP00000026671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000147781]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026671
AA Change: D1153G

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: D1153G

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART
Pfam:HEAT_2	559	668	7.9e-11	PFAM
Pfam:HEAT	602	630	1.9e-6	PFAM
low complexity region	755	772	N/A	INTRINSIC
low complexity region	877	887	N/A	INTRINSIC
low complexity region	939	945	N/A	INTRINSIC
WD40	1012	1050	2.56e1	SMART
WD40	1052	1097	4.28e0	SMART
WD40	1105	1151	1.83e2	SMART
WD40	1154	1194	1.82e-2	SMART
WD40	1200	1240	5.35e-1	SMART
WD40	1246	1281	7.13e0	SMART
WD40	1283	1329	2.67e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000136662

SMART Domains

Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
low complexity region	172	182	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147781

SMART Domains

Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agpat3	A	T	10: 78,110,086 (GRCm39)	Y288N	probably damaging	Het
Ano5	A	G	7: 51,203,626 (GRCm39)	K225E	probably benign	Het
Apob	A	G	12: 8,056,356 (GRCm39)	T1613A	probably benign	Het
Ascc3	A	G	10: 50,725,693 (GRCm39)	T2139A	probably benign	Het
Asnsd1	A	T	1: 53,386,172 (GRCm39)		probably null	Het
Atp23	C	T	10: 126,723,407 (GRCm39)	A232T	probably damaging	Het
Cd8b1	G	A	6: 71,306,777 (GRCm39)		probably null	Het
Cep295	G	A	9: 15,234,202 (GRCm39)	T2198I	probably damaging	Het
Col12a1	G	T	9: 79,588,694 (GRCm39)	N1140K	probably damaging	Het
Cyp2f2	A	G	7: 26,821,294 (GRCm39)	Y69C	probably damaging	Het
Ep400	C	T	5: 110,887,200 (GRCm39)	A628T	probably damaging	Het
Faxc	A	T	4: 21,932,046 (GRCm39)		probably null	Het
Fpr3	T	C	17: 18,191,436 (GRCm39)	S236P	probably benign	Het
Fsip2	T	C	2: 82,822,239 (GRCm39)	S5991P	possibly damaging	Het
Gm3099	A	T	14: 15,345,347 (GRCm39)	N58Y	probably damaging	Het
Gmps	T	C	3: 63,887,615 (GRCm39)	V29A	probably benign	Het
Gnptab	T	G	10: 88,250,348 (GRCm39)	D153E	probably benign	Het
Kcnh6	A	G	11: 105,911,062 (GRCm39)	H486R	probably damaging	Het
Lama3	T	C	18: 12,673,670 (GRCm39)	Y2571H	probably damaging	Het
Lama5	C	T	2: 179,837,401 (GRCm39)	V995M	probably damaging	Het
Lrrc43	A	G	5: 123,632,328 (GRCm39)	N157S	probably damaging	Het
Mbtps1	G	A	8: 120,272,923 (GRCm39)	S74L	probably benign	Het
Muc16	A	T	9: 18,571,181 (GRCm39)	V446D	unknown	Het
Ncapg2	T	C	12: 116,403,647 (GRCm39)	V853A	possibly damaging	Het
Nkx2-6	T	C	14: 69,409,476 (GRCm39)	S76P	probably benign	Het
Nuak1	T	C	10: 84,229,981 (GRCm39)	I131V	probably damaging	Het
Nup50l	A	C	6: 96,142,655 (GRCm39)	S130A	probably benign	Het
Oas1e	A	T	5: 120,925,008 (GRCm39)		probably null	Het
Or1n2	T	C	2: 36,797,149 (GRCm39)	F64L	probably benign	Het
Pde5a	T	C	3: 122,542,128 (GRCm39)		probably null	Het
Plin4	T	C	17: 56,413,861 (GRCm39)	T255A	probably benign	Het
Pygm	A	G	19: 6,438,117 (GRCm39)	T141A	possibly damaging	Het
Rps2	T	A	17: 24,939,334 (GRCm39)		probably benign	Het
Ryr2	A	G	13: 11,814,718 (GRCm39)	F685L	probably damaging	Het
Slc22a17	A	G	14: 55,146,051 (GRCm39)	I356T	probably benign	Het
Slc29a4	T	G	5: 142,703,584 (GRCm39)	I286S	probably benign	Het
Swap70	T	C	7: 109,821,105 (GRCm39)	S30P	possibly damaging	Het
Tbc1d10c	A	G	19: 4,234,744 (GRCm39)	F439S	probably damaging	Het
Tbx3	T	A	5: 119,818,841 (GRCm39)	L472Q	probably damaging	Het
Tbxas1	A	G	6: 39,004,850 (GRCm39)	R366G	possibly damaging	Het
Ttll8	T	C	15: 88,798,638 (GRCm39)	D699G	probably benign	Het
Vmn1r128	A	T	7: 21,083,597 (GRCm39)	R100S	probably damaging	Het
Wdpcp	A	G	11: 21,698,931 (GRCm39)	D570G	probably damaging	Het
Znfx1	A	G	2: 166,897,575 (GRCm39)	S450P	probably damaging	Het

Other mutations in Rptor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Rptor	APN	11	119,690,271 (GRCm39)	missense	possibly damaging	0.92
IGL01319:Rptor	APN	11	119,781,996 (GRCm39)	missense	probably benign	0.01
IGL01375:Rptor	APN	11	119,787,262 (GRCm39)	missense	possibly damaging	0.68
IGL01899:Rptor	APN	11	119,748,279 (GRCm39)	missense	probably benign	0.04
IGL01927:Rptor	APN	11	119,548,500 (GRCm39)	missense	probably damaging	1.00
IGL02312:Rptor	APN	11	119,737,741 (GRCm39)	missense	possibly damaging	0.84
IGL02620:Rptor	APN	11	119,671,413 (GRCm39)	missense	probably benign	0.12
IGL02651:Rptor	APN	11	119,783,438 (GRCm39)	missense	possibly damaging	0.69
IGL03182:Rptor	APN	11	119,615,971 (GRCm39)	missense	probably damaging	1.00
Velocipede	UTSW	11	119,786,803 (GRCm39)	missense	possibly damaging	0.92
R0103:Rptor	UTSW	11	119,775,793 (GRCm39)	missense	probably benign	0.01
R0179:Rptor	UTSW	11	119,763,193 (GRCm39)	missense	probably benign	0.14
R0217:Rptor	UTSW	11	119,785,738 (GRCm39)	splice site	probably benign
R0219:Rptor	UTSW	11	119,712,603 (GRCm39)	intron	probably benign
R0324:Rptor	UTSW	11	119,783,467 (GRCm39)	missense	probably damaging	1.00
R0432:Rptor	UTSW	11	119,671,379 (GRCm39)	nonsense	probably null
R0718:Rptor	UTSW	11	119,763,202 (GRCm39)	missense	probably benign	0.15
R0730:Rptor	UTSW	11	119,775,780 (GRCm39)	missense	probably benign	0.06
R1019:Rptor	UTSW	11	119,734,569 (GRCm39)	missense	probably damaging	1.00
R1073:Rptor	UTSW	11	119,634,717 (GRCm39)	missense	possibly damaging	0.93
R1424:Rptor	UTSW	11	119,671,419 (GRCm39)	nonsense	probably null
R1579:Rptor	UTSW	11	119,786,827 (GRCm39)	missense	probably benign	0.00
R1766:Rptor	UTSW	11	119,615,887 (GRCm39)	missense	probably damaging	0.99
R1844:Rptor	UTSW	11	119,647,146 (GRCm39)	missense	probably damaging	1.00
R2180:Rptor	UTSW	11	119,615,970 (GRCm39)	missense	probably damaging	1.00
R2274:Rptor	UTSW	11	119,647,148 (GRCm39)	nonsense	probably null
R2275:Rptor	UTSW	11	119,647,148 (GRCm39)	nonsense	probably null
R2408:Rptor	UTSW	11	119,748,277 (GRCm39)	missense	probably damaging	0.99
R2981:Rptor	UTSW	11	119,756,420 (GRCm39)	missense	probably damaging	1.00
R2996:Rptor	UTSW	11	119,747,124 (GRCm39)	missense	probably damaging	1.00
R3001:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R3002:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R3003:Rptor	UTSW	11	119,763,197 (GRCm39)	missense	possibly damaging	0.94
R4358:Rptor	UTSW	11	119,562,171 (GRCm39)	missense	probably damaging	0.98
R4592:Rptor	UTSW	11	119,689,666 (GRCm39)	missense	probably null	1.00
R4647:Rptor	UTSW	11	119,781,989 (GRCm39)	missense	probably benign	0.33
R4666:Rptor	UTSW	11	119,634,708 (GRCm39)	missense	probably damaging	1.00
R4958:Rptor	UTSW	11	119,748,217 (GRCm39)	missense	probably benign	0.29
R4974:Rptor	UTSW	11	119,712,466 (GRCm39)	intron	probably benign
R5073:Rptor	UTSW	11	119,787,305 (GRCm39)	missense	possibly damaging	0.71
R5199:Rptor	UTSW	11	119,494,642 (GRCm39)	missense	probably benign
R5216:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5219:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5277:Rptor	UTSW	11	119,713,782 (GRCm39)	missense	probably damaging	1.00
R5365:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5366:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5447:Rptor	UTSW	11	119,734,539 (GRCm39)	missense	probably damaging	0.98
R5630:Rptor	UTSW	11	119,647,075 (GRCm39)	missense	probably benign	0.01
R6220:Rptor	UTSW	11	119,788,268 (GRCm39)	missense	possibly damaging	0.83
R6567:Rptor	UTSW	11	119,786,838 (GRCm39)	missense	probably benign	0.00
R6741:Rptor	UTSW	11	119,786,803 (GRCm39)	missense	possibly damaging	0.92
R6915:Rptor	UTSW	11	119,647,171 (GRCm39)	missense	probably damaging	0.99
R7032:Rptor	UTSW	11	119,737,762 (GRCm39)	missense	probably benign	0.00
R7051:Rptor	UTSW	11	119,765,012 (GRCm39)	utr 3 prime	probably benign
R7396:Rptor	UTSW	11	119,763,181 (GRCm39)	missense	probably benign	0.10
R7429:Rptor	UTSW	11	119,737,654 (GRCm39)	missense	probably damaging	1.00
R7430:Rptor	UTSW	11	119,737,654 (GRCm39)	missense	probably damaging	1.00
R7447:Rptor	UTSW	11	119,775,805 (GRCm39)	missense	probably benign	0.00
R7595:Rptor	UTSW	11	119,634,779 (GRCm39)	missense	possibly damaging	0.82
R7776:Rptor	UTSW	11	119,783,453 (GRCm39)	missense	probably benign	0.01
R7854:Rptor	UTSW	11	119,748,779 (GRCm39)	missense	probably benign	0.02
R8288:Rptor	UTSW	11	119,748,763 (GRCm39)	missense	probably benign	0.02
R8305:Rptor	UTSW	11	119,702,812 (GRCm39)	missense	probably damaging	1.00
R8328:Rptor	UTSW	11	119,783,473 (GRCm39)	missense	probably benign	0.00
R8772:Rptor	UTSW	11	119,615,858 (GRCm39)	missense	probably damaging	1.00
R8871:Rptor	UTSW	11	119,494,751 (GRCm39)	missense	probably benign	0.01
R8925:Rptor	UTSW	11	119,782,036 (GRCm39)	missense	probably benign	0.11
R8927:Rptor	UTSW	11	119,782,036 (GRCm39)	missense	probably benign	0.11
R8981:Rptor	UTSW	11	119,734,508 (GRCm39)	missense	possibly damaging	0.90
R9149:Rptor	UTSW	11	119,777,896 (GRCm39)	missense	probably benign	0.05
R9213:Rptor	UTSW	11	119,494,765 (GRCm39)	missense	probably benign
R9224:Rptor	UTSW	11	119,785,113 (GRCm39)	missense	probably benign	0.11
R9290:Rptor	UTSW	11	119,702,823 (GRCm39)	missense	probably benign	0.00
R9314:Rptor	UTSW	11	119,786,772 (GRCm39)	missense	probably benign	0.43
R9371:Rptor	UTSW	11	119,562,152 (GRCm39)	missense	possibly damaging	0.66
R9719:Rptor	UTSW	11	119,781,940 (GRCm39)	missense	probably benign	0.13
R9751:Rptor	UTSW	11	119,777,964 (GRCm39)	missense	probably benign	0.02
X0050:Rptor	UTSW	11	119,737,231 (GRCm39)	missense	probably benign	0.14
X0066:Rptor	UTSW	11	119,748,692 (GRCm39)	missense	probably benign	0.31
Z0001:Rptor	UTSW	11	119,762,318 (GRCm39)	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119,748,279 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,742,294 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,737,578 (GRCm39)	critical splice acceptor site	probably null
Z0001:Rptor	UTSW	11	119,690,145 (GRCm39)	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119,647,241 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,647,062 (GRCm39)	splice site	probably null
Z0001:Rptor	UTSW	11	119,494,798 (GRCm39)	critical splice donor site	probably null
Z0001:Rptor	UTSW	11	119,787,375 (GRCm39)	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119,764,977 (GRCm39)	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TCGGAGCGTTGTTGAAGTAAC -3'
(R):5'- ACAATCAGTGTGTACCCAGG -3'

Sequencing Primer
(F):5'- TTGTTGAAGTAACCCAGCCG -3'
(R):5'- CAGTGTGTACCCAGGAATAATTAGC -3'

Posted On

2021-01-18