Incidental Mutation 'R8353:Trim69'
ID660516
Institutional Source Beutler Lab
Gene Symbol Trim69
Ensembl Gene ENSMUSG00000033368
Gene Nametripartite motif-containing 69
Synonyms4921519C19Rik, Rnf36, Trif
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8353 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122160700-122179027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122168009 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 154 (I154T)
Ref Sequence ENSEMBL: ENSMUSP00000047627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]
Predicted Effect probably benign
Transcript: ENSMUST00000028665
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036089
AA Change: I154T

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368
AA Change: I154T

DomainStartEndE-ValueType
RING 42 82 8.48e-8 SMART
low complexity region 95 111 N/A INTRINSIC
PDB:4NQJ|C 144 322 2e-86 PDB
PRY 323 375 9.37e-19 SMART
SPRY 376 500 4.97e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T A 16: 14,038,013 probably null Het
9930021J03Rik T C 19: 29,753,842 H590R possibly damaging Het
Abr T C 11: 76,419,833 T752A probably damaging Het
Adar A G 3: 89,750,262 T508A possibly damaging Het
Atxn3 T A 12: 101,945,900 K85I probably benign Het
Atxn7l1 G T 12: 33,147,883 W50L probably damaging Het
Bahcc1 T C 11: 120,274,425 V894A probably damaging Het
Bloc1s3 G T 7: 19,507,399 T68K probably benign Het
C130073F10Rik C T 4: 101,890,684 probably null Het
C330027C09Rik C T 16: 49,001,073 Q181* probably null Het
Cd55b T C 1: 130,414,133 I256V probably benign Het
Celsr3 T A 9: 108,826,535 D72E probably benign Het
Cep41 T C 6: 30,658,892 D152G probably benign Het
Cpne8 C A 15: 90,541,293 K285N possibly damaging Het
Csmd3 A T 15: 47,949,953 I1061K probably damaging Het
Cspg4 A T 9: 56,898,669 N2255Y probably damaging Het
Cym T A 3: 107,221,709 probably benign Het
Cyp2d9 T C 15: 82,452,519 V23A probably damaging Het
Dnah1 A T 14: 31,283,202 I2365K probably benign Het
Dock5 C T 14: 67,817,508 probably null Het
Dopey1 A T 9: 86,521,586 H1613L probably damaging Het
Dusp5 T C 19: 53,529,682 V122A possibly damaging Het
Emc6 A G 11: 73,176,573 L44P probably damaging Het
Fbxl6 G T 15: 76,538,478 T80K probably benign Het
Frrs1 T A 3: 116,899,173 M32K possibly damaging Het
Gfod1 A G 13: 43,200,890 V203A possibly damaging Het
Gjc2 G A 11: 59,177,014 A214V unknown Het
Gkn2 T C 6: 87,378,153 Y115H probably damaging Het
Gpatch1 A C 7: 35,277,279 probably benign Het
Hemgn G T 4: 46,403,935 P20Q possibly damaging Het
Herc1 G T 9: 66,508,289 V4849L possibly damaging Het
Hmcn2 A T 2: 31,385,341 probably null Het
Htt C A 5: 34,877,155 T1990N possibly damaging Het
Jrk C T 15: 74,706,625 W270* probably null Het
Katnb1 A G 8: 95,095,444 D266G probably damaging Het
Klhl42 A G 6: 147,107,923 K420R probably damaging Het
Lamb1 C A 12: 31,306,999 T1035K probably damaging Het
Laptm5 T C 4: 130,928,768 probably null Het
Lilra5 T C 7: 4,237,972 S22P probably benign Het
Mn1 A G 5: 111,420,639 N825S possibly damaging Het
Mup17 C T 4: 61,592,182 probably null Het
Ncapd3 T A 9: 27,071,804 D949E probably benign Het
Ncoa7 T C 10: 30,694,159 E230G probably damaging Het
Nxnl1 A G 8: 71,562,868 V132A probably damaging Het
Oard1 A G 17: 48,416,760 I145V probably benign Het
Pabpc4 T G 4: 123,296,053 L555R probably benign Het
Ppp1r11 G T 17: 36,949,974 S21R possibly damaging Het
Prr36 T C 8: 4,213,831 probably benign Het
Serpina1a T A 12: 103,855,779 D298V probably benign Het
Sqle A T 15: 59,324,465 H369L possibly damaging Het
Stambp T C 6: 83,561,899 E173G probably damaging Het
Syne1 T C 10: 5,350,983 N915S probably damaging Het
Tjap1 C A 17: 46,282,604 probably benign Het
Tmem62 A C 2: 120,984,336 K30T probably damaging Het
Tmtc1 T C 6: 148,425,848 T56A probably benign Het
Trav6-4 A T 14: 53,454,489 M18L probably benign Het
Uggt1 T C 1: 36,170,296 probably null Het
Usp48 T A 4: 137,623,382 M60K probably benign Het
Usp7 A G 16: 8,695,871 S753P probably benign Het
Vmn2r27 A C 6: 124,192,445 N575K probably damaging Het
Wdfy4 A C 14: 32,973,624 D2672E probably benign Het
Zdhhc17 G A 10: 111,009,942 P30L probably benign Het
Zmym4 T A 4: 126,907,112 Y565F possibly damaging Het
Other mutations in Trim69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Trim69 APN 2 122167714 missense probably benign 0.00
IGL01321:Trim69 APN 2 122173284 missense possibly damaging 0.84
IGL01478:Trim69 APN 2 122178443 missense probably damaging 0.98
IGL01907:Trim69 APN 2 122167661 missense probably benign 0.00
IGL01925:Trim69 APN 2 122167916 missense probably damaging 1.00
IGL03065:Trim69 APN 2 122178634 missense probably damaging 0.98
IGL03121:Trim69 APN 2 122167647 missense probably benign 0.22
IGL03206:Trim69 APN 2 122173155 missense probably benign 0.00
R0019:Trim69 UTSW 2 122174477 splice site probably null
R0019:Trim69 UTSW 2 122174477 splice site probably null
R1956:Trim69 UTSW 2 122174475 critical splice donor site probably null
R1960:Trim69 UTSW 2 122167684 missense probably benign 0.00
R2212:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3412:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3414:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3900:Trim69 UTSW 2 122178841 missense probably benign 0.03
R4470:Trim69 UTSW 2 122178599 missense probably damaging 1.00
R4950:Trim69 UTSW 2 122178746 missense probably damaging 1.00
R5045:Trim69 UTSW 2 122174246 missense probably benign 0.08
R5237:Trim69 UTSW 2 122173340 missense probably benign
R5931:Trim69 UTSW 2 122178594 missense probably damaging 0.98
R6483:Trim69 UTSW 2 122167600 nonsense probably null
R6872:Trim69 UTSW 2 122167910 missense probably damaging 1.00
R7372:Trim69 UTSW 2 122178583 missense possibly damaging 0.94
R7451:Trim69 UTSW 2 122168027 missense probably benign 0.19
R7591:Trim69 UTSW 2 122167973 missense probably benign 0.17
R8551:Trim69 UTSW 2 122173329 missense probably benign 0.00
Z1176:Trim69 UTSW 2 122167554 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCAACCTCGTGCTGGAGAAG -3'
(R):5'- TCAGCCATAGCGCCTTTAGAG -3'

Sequencing Primer
(F):5'- GCTCGTGGAGAAGATTAAGAAGTTAC -3'
(R):5'- TTTCCTGTACATAGCATCTCTAGAG -3'
Posted On2021-01-18