Incidental Mutation 'R8353:Lilra5'
ID660533
Institutional Source Beutler Lab
Gene Symbol Lilra5
Ensembl Gene ENSMUSG00000070873
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
SynonymsGm4878
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8353 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4237754-4243463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4237972 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 22 (S22P)
Ref Sequence ENSEMBL: ENSMUSP00000113091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117550]
Predicted Effect probably benign
Transcript: ENSMUST00000117550
AA Change: S22P

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113091
Gene: ENSMUSG00000070873
AA Change: S22P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 34 118 4.67e-4 SMART
IG_like 129 217 5.13e0 SMART
transmembrane domain 250 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T A 16: 14,038,013 probably null Het
9930021J03Rik T C 19: 29,753,842 H590R possibly damaging Het
Abr T C 11: 76,419,833 T752A probably damaging Het
Adar A G 3: 89,750,262 T508A possibly damaging Het
Atxn3 T A 12: 101,945,900 K85I probably benign Het
Atxn7l1 G T 12: 33,147,883 W50L probably damaging Het
Bahcc1 T C 11: 120,274,425 V894A probably damaging Het
Bloc1s3 G T 7: 19,507,399 T68K probably benign Het
C130073F10Rik C T 4: 101,890,684 probably null Het
C330027C09Rik C T 16: 49,001,073 Q181* probably null Het
Cd55b T C 1: 130,414,133 I256V probably benign Het
Celsr3 T A 9: 108,826,535 D72E probably benign Het
Cep41 T C 6: 30,658,892 D152G probably benign Het
Cpne8 C A 15: 90,541,293 K285N possibly damaging Het
Csmd3 A T 15: 47,949,953 I1061K probably damaging Het
Cspg4 A T 9: 56,898,669 N2255Y probably damaging Het
Cym T A 3: 107,221,709 probably benign Het
Cyp2d9 T C 15: 82,452,519 V23A probably damaging Het
Dnah1 A T 14: 31,283,202 I2365K probably benign Het
Dock5 C T 14: 67,817,508 probably null Het
Dopey1 A T 9: 86,521,586 H1613L probably damaging Het
Dusp5 T C 19: 53,529,682 V122A possibly damaging Het
Emc6 A G 11: 73,176,573 L44P probably damaging Het
Fbxl6 G T 15: 76,538,478 T80K probably benign Het
Frrs1 T A 3: 116,899,173 M32K possibly damaging Het
Gfod1 A G 13: 43,200,890 V203A possibly damaging Het
Gjc2 G A 11: 59,177,014 A214V unknown Het
Gkn2 T C 6: 87,378,153 Y115H probably damaging Het
Gpatch1 A C 7: 35,277,279 probably benign Het
Hemgn G T 4: 46,403,935 P20Q possibly damaging Het
Herc1 G T 9: 66,508,289 V4849L possibly damaging Het
Hmcn2 A T 2: 31,385,341 probably null Het
Htt C A 5: 34,877,155 T1990N possibly damaging Het
Jrk C T 15: 74,706,625 W270* probably null Het
Katnb1 A G 8: 95,095,444 D266G probably damaging Het
Klhl42 A G 6: 147,107,923 K420R probably damaging Het
Lamb1 C A 12: 31,306,999 T1035K probably damaging Het
Laptm5 T C 4: 130,928,768 probably null Het
Mn1 A G 5: 111,420,639 N825S possibly damaging Het
Mup17 C T 4: 61,592,182 probably null Het
Ncapd3 T A 9: 27,071,804 D949E probably benign Het
Ncoa7 T C 10: 30,694,159 E230G probably damaging Het
Nxnl1 A G 8: 71,562,868 V132A probably damaging Het
Oard1 A G 17: 48,416,760 I145V probably benign Het
Pabpc4 T G 4: 123,296,053 L555R probably benign Het
Ppp1r11 G T 17: 36,949,974 S21R possibly damaging Het
Prr36 T C 8: 4,213,831 probably benign Het
Serpina1a T A 12: 103,855,779 D298V probably benign Het
Sqle A T 15: 59,324,465 H369L possibly damaging Het
Stambp T C 6: 83,561,899 E173G probably damaging Het
Syne1 T C 10: 5,350,983 N915S probably damaging Het
Tjap1 C A 17: 46,282,604 probably benign Het
Tmem62 A C 2: 120,984,336 K30T probably damaging Het
Tmtc1 T C 6: 148,425,848 T56A probably benign Het
Trav6-4 A T 14: 53,454,489 M18L probably benign Het
Trim69 T C 2: 122,168,009 I154T possibly damaging Het
Uggt1 T C 1: 36,170,296 probably null Het
Usp48 T A 4: 137,623,382 M60K probably benign Het
Usp7 A G 16: 8,695,871 S753P probably benign Het
Vmn2r27 A C 6: 124,192,445 N575K probably damaging Het
Wdfy4 A C 14: 32,973,624 D2672E probably benign Het
Zdhhc17 G A 10: 111,009,942 P30L probably benign Het
Zmym4 T A 4: 126,907,112 Y565F possibly damaging Het
Other mutations in Lilra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Lilra5 APN 7 4237969 missense probably benign
IGL02281:Lilra5 APN 7 4238783 missense probably benign 0.00
R0458:Lilra5 UTSW 7 4238219 missense probably benign 0.26
R0611:Lilra5 UTSW 7 4242233 missense probably benign
R0685:Lilra5 UTSW 7 4241957 splice site probably benign
R3195:Lilra5 UTSW 7 4238757 missense probably damaging 0.96
R4726:Lilra5 UTSW 7 4237958 missense probably benign 0.00
R4745:Lilra5 UTSW 7 4242077 missense possibly damaging 0.72
R4836:Lilra5 UTSW 7 4238714 missense possibly damaging 0.71
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6263:Lilra5 UTSW 7 4238361 missense probably damaging 1.00
R6266:Lilra5 UTSW 7 4241928 missense possibly damaging 0.84
R6285:Lilra5 UTSW 7 4242115 missense probably damaging 1.00
R6292:Lilra5 UTSW 7 4238339 missense possibly damaging 0.81
R6344:Lilra5 UTSW 7 4238786 missense probably damaging 1.00
R6861:Lilra5 UTSW 7 4241932 missense probably benign 0.14
R8681:Lilra5 UTSW 7 4238217 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGAAAGTGCCATGACCTTCG -3'
(R):5'- TGTGCGGATTCCCTGCAAAG -3'

Sequencing Primer
(F):5'- GAAAGTGCCATGACCTTCGTCTTC -3'
(R):5'- TGCGGATTCCCTGCAAAGAAATG -3'
Posted On2021-01-18