Mutagenetix > Incidental Mutations

Incidental Mutation 'R8353:Herc1'

660540

Institutional Source

Beutler Lab

Gene Symbol

Herc1

Ensembl Gene

ENSMUSG00000038664

Gene Name

HECT and RLD domain containing E3 ubiquitin protein ligase family member 1

Synonyms

tbl, D130015N03Rik, 2810449H11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8353 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

66350450-66508775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 66508289 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 4849 (V4849L)

Ref Sequence

ENSEMBL: ENSMUSP00000044801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042824] [ENSMUST00000056890]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042824
AA Change: V4849L

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000044801
Gene: ENSMUSG00000038664
AA Change: V4849L

Domain	Start	End	E-Value	Type
low complexity region	79	90	N/A	INTRINSIC
low complexity region	136	147	N/A	INTRINSIC
Pfam:RCC1	476	526	5.4e-15	PFAM
Pfam:RCC1_2	513	542	1.3e-9	PFAM
Pfam:RCC1	529	576	5.5e-16	PFAM
Pfam:RCC1	579	629	1.5e-10	PFAM
Pfam:RCC1	632	680	3.6e-9	PFAM
Pfam:RCC1_2	667	696	2.2e-11	PFAM
Pfam:RCC1	683	733	1.2e-14	PFAM
low complexity region	787	807	N/A	INTRINSIC
low complexity region	852	864	N/A	INTRINSIC
low complexity region	1014	1025	N/A	INTRINSIC
low complexity region	1080	1100	N/A	INTRINSIC
low complexity region	1348	1378	N/A	INTRINSIC
low complexity region	1659	1676	N/A	INTRINSIC
low complexity region	1865	1874	N/A	INTRINSIC
low complexity region	2002	2030	N/A	INTRINSIC
SPRY	2067	2188	1.8e-30	SMART
coiled coil region	2251	2280	N/A	INTRINSIC
low complexity region	2410	2423	N/A	INTRINSIC
low complexity region	2613	2629	N/A	INTRINSIC
low complexity region	2633	2648	N/A	INTRINSIC
low complexity region	2650	2667	N/A	INTRINSIC
low complexity region	2736	2749	N/A	INTRINSIC
low complexity region	2882	2896	N/A	INTRINSIC
low complexity region	2924	2935	N/A	INTRINSIC
low complexity region	2971	2987	N/A	INTRINSIC
low complexity region	3045	3051	N/A	INTRINSIC
low complexity region	3168	3186	N/A	INTRINSIC
low complexity region	3191	3213	N/A	INTRINSIC
low complexity region	3364	3379	N/A	INTRINSIC
WD40	3415	3454	1.68e-6	SMART
WD40	3570	3608	3.68e1	SMART
WD40	3613	3652	4.3e-1	SMART
WD40	3657	3702	3.17e-2	SMART
WD40	3734	3773	8.29e-6	SMART
low complexity region	3950	3964	N/A	INTRINSIC
Pfam:RCC1_2	4079	4111	7.3e-9	PFAM
Pfam:RCC1	4098	4147	3.4e-16	PFAM
Pfam:RCC1_2	4134	4163	1.8e-7	PFAM
Pfam:RCC1	4150	4199	7.2e-16	PFAM
Pfam:RCC1	4204	4252	6.1e-12	PFAM
Pfam:RCC1	4255	4304	2.4e-7	PFAM
Pfam:RCC1_2	4291	4320	5.8e-12	PFAM
Pfam:RCC1	4307	4356	8.9e-16	PFAM
Blast:HECTc	4389	4423	2e-11	BLAST
HECTc	4497	4846	8.2e-148	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000056890

SMART Domains

Protein: ENSMUSP00000060137
Gene: ENSMUSG00000050503

Domain	Start	End	E-Value	Type
FBOX	6	46	4.46e-2	SMART
LRR	113	138	1.89e-1	SMART
LRR	139	164	3.44e-4	SMART
LRR	165	190	1.66e2	SMART
low complexity region	216	223	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gen encodes a member of the HERC protein family. This protein stimulates guanine nucleotide exchange on ARF1 and Rab proteins. This protein may be involved in membrane transport processes. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for this spontaneous mutation exhibit an abnormal cerebellar Purkinje cell layer and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900011O08Rik	T	A	16: 14,038,013		probably null	Het
9930021J03Rik	T	C	19: 29,753,842	H590R	possibly damaging	Het
Abr	T	C	11: 76,419,833	T752A	probably damaging	Het
Adar	A	G	3: 89,750,262	T508A	possibly damaging	Het
Atxn3	T	A	12: 101,945,900	K85I	probably benign	Het
Atxn7l1	G	T	12: 33,147,883	W50L	probably damaging	Het
Bahcc1	T	C	11: 120,274,425	V894A	probably damaging	Het
Bloc1s3	G	T	7: 19,507,399	T68K	probably benign	Het
C130073F10Rik	C	T	4: 101,890,684		probably null	Het
C330027C09Rik	C	T	16: 49,001,073	Q181*	probably null	Het
Cd55b	T	C	1: 130,414,133	I256V	probably benign	Het
Celsr3	T	A	9: 108,826,535	D72E	probably benign	Het
Cep41	T	C	6: 30,658,892	D152G	probably benign	Het
Cpne8	C	A	15: 90,541,293	K285N	possibly damaging	Het
Csmd3	A	T	15: 47,949,953	I1061K	probably damaging	Het
Cspg4	A	T	9: 56,898,669	N2255Y	probably damaging	Het
Cym	T	A	3: 107,221,709		probably benign	Het
Cyp2d9	T	C	15: 82,452,519	V23A	probably damaging	Het
Dnah1	A	T	14: 31,283,202	I2365K	probably benign	Het
Dock5	C	T	14: 67,817,508		probably null	Het
Dopey1	A	T	9: 86,521,586	H1613L	probably damaging	Het
Dusp5	T	C	19: 53,529,682	V122A	possibly damaging	Het
Emc6	A	G	11: 73,176,573	L44P	probably damaging	Het
Fbxl6	G	T	15: 76,538,478	T80K	probably benign	Het
Frrs1	T	A	3: 116,899,173	M32K	possibly damaging	Het
Gfod1	A	G	13: 43,200,890	V203A	possibly damaging	Het
Gjc2	G	A	11: 59,177,014	A214V	unknown	Het
Gkn2	T	C	6: 87,378,153	Y115H	probably damaging	Het
Gpatch1	A	C	7: 35,277,279		probably benign	Het
Hemgn	G	T	4: 46,403,935	P20Q	possibly damaging	Het
Hmcn2	A	T	2: 31,385,341		probably null	Het
Htt	C	A	5: 34,877,155	T1990N	possibly damaging	Het
Jrk	C	T	15: 74,706,625	W270*	probably null	Het
Katnb1	A	G	8: 95,095,444	D266G	probably damaging	Het
Klhl42	A	G	6: 147,107,923	K420R	probably damaging	Het
Lamb1	C	A	12: 31,306,999	T1035K	probably damaging	Het
Laptm5	T	C	4: 130,928,768		probably null	Het
Lilra5	T	C	7: 4,237,972	S22P	probably benign	Het
Mn1	A	G	5: 111,420,639	N825S	possibly damaging	Het
Mup17	C	T	4: 61,592,182		probably null	Het
Ncapd3	T	A	9: 27,071,804	D949E	probably benign	Het
Ncoa7	T	C	10: 30,694,159	E230G	probably damaging	Het
Nxnl1	A	G	8: 71,562,868	V132A	probably damaging	Het
Oard1	A	G	17: 48,416,760	I145V	probably benign	Het
Pabpc4	T	G	4: 123,296,053	L555R	probably benign	Het
Ppp1r11	G	T	17: 36,949,974	S21R	possibly damaging	Het
Prr36	T	C	8: 4,213,831		probably benign	Het
Serpina1a	T	A	12: 103,855,779	D298V	probably benign	Het
Sqle	A	T	15: 59,324,465	H369L	possibly damaging	Het
Stambp	T	C	6: 83,561,899	E173G	probably damaging	Het
Syne1	T	C	10: 5,350,983	N915S	probably damaging	Het
Tjap1	C	A	17: 46,282,604		probably benign	Het
Tmem62	A	C	2: 120,984,336	K30T	probably damaging	Het
Tmtc1	T	C	6: 148,425,848	T56A	probably benign	Het
Trav6-4	A	T	14: 53,454,489	M18L	probably benign	Het
Trim69	T	C	2: 122,168,009	I154T	possibly damaging	Het
Uggt1	T	C	1: 36,170,296		probably null	Het
Usp48	T	A	4: 137,623,382	M60K	probably benign	Het
Usp7	A	G	16: 8,695,871	S753P	probably benign	Het
Vmn2r27	A	C	6: 124,192,445	N575K	probably damaging	Het
Wdfy4	A	C	14: 32,973,624	D2672E	probably benign	Het
Zdhhc17	G	A	10: 111,009,942	P30L	probably benign	Het
Zmym4	T	A	4: 126,907,112	Y565F	possibly damaging	Het

Other mutations in Herc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Herc1	APN	9	66483966	missense	probably benign	0.02
IGL00159:Herc1	APN	9	66437682	missense	possibly damaging	0.94
IGL00486:Herc1	APN	9	66476120	missense	probably benign
IGL00717:Herc1	APN	9	66485002	missense	probably damaging	1.00
IGL00766:Herc1	APN	9	66450741	missense	probably damaging	1.00
IGL00776:Herc1	APN	9	66421038	missense	probably benign
IGL00987:Herc1	APN	9	66408052	missense	probably benign	0.07
IGL01090:Herc1	APN	9	66469175	nonsense	probably null
IGL01098:Herc1	APN	9	66461922	critical splice donor site	probably null
IGL01106:Herc1	APN	9	66476438	splice site	probably benign
IGL01120:Herc1	APN	9	66428880	missense	probably benign
IGL01359:Herc1	APN	9	66439268	missense	probably benign	0.01
IGL01360:Herc1	APN	9	66483699	missense	probably benign
IGL01364:Herc1	APN	9	66399361	missense	probably benign	0.00
IGL01470:Herc1	APN	9	66497636	missense	possibly damaging	0.94
IGL01670:Herc1	APN	9	66487060	missense	probably damaging	1.00
IGL01825:Herc1	APN	9	66399807	missense	probably benign	0.00
IGL01903:Herc1	APN	9	66386872	nonsense	probably null
IGL01988:Herc1	APN	9	66488075	splice site	probably benign
IGL02074:Herc1	APN	9	66450983	missense	probably benign
IGL02089:Herc1	APN	9	66480869	missense	probably damaging	1.00
IGL02177:Herc1	APN	9	66434511	missense	probably benign
IGL02300:Herc1	APN	9	66476363	missense	probably benign	0.01
IGL02304:Herc1	APN	9	66476414	missense	probably benign	0.06
IGL02369:Herc1	APN	9	66492011	nonsense	probably null
IGL02445:Herc1	APN	9	66433482	missense	possibly damaging	0.95
IGL02447:Herc1	APN	9	66497328	missense	possibly damaging	0.59
IGL02549:Herc1	APN	9	66399901	missense	probably damaging	0.98
IGL02571:Herc1	APN	9	66434605	splice site	probably benign
IGL02709:Herc1	APN	9	66497680	missense	probably damaging	0.97
IGL02717:Herc1	APN	9	66371921	nonsense	probably null
IGL02726:Herc1	APN	9	66441988	missense	probably benign	0.37
IGL02733:Herc1	APN	9	66450992	missense	probably benign
IGL02963:Herc1	APN	9	66388823	missense	probably damaging	0.99
IGL03101:Herc1	APN	9	66487997	missense	probably benign
IGL03193:Herc1	APN	9	66402680	missense	probably benign
IGL03203:Herc1	APN	9	66388900	critical splice donor site	probably null
IGL03216:Herc1	APN	9	66478946	missense	probably benign	0.06
IGL03282:Herc1	APN	9	66451459	missense	probably benign	0.05
IGL03295:Herc1	APN	9	66396703	missense	possibly damaging	0.56
miracles	UTSW	9	66462837	nonsense	probably null
newton	UTSW	9	66467803	missense	probably damaging	1.00
R0907_Herc1_362	UTSW	9	66433428	missense	possibly damaging	0.94
R4427_Herc1_231	UTSW	9	66496005	missense	probably damaging	1.00
stables	UTSW	9	66479453	missense	probably benign	0.13
IGL03134:Herc1	UTSW	9	66434063	critical splice acceptor site	probably benign
PIT4243001:Herc1	UTSW	9	66372207	missense	probably benign	0.00
PIT4486001:Herc1	UTSW	9	66372389	missense	probably damaging	1.00
PIT4696001:Herc1	UTSW	9	66479009	missense	probably damaging	1.00
R0044:Herc1	UTSW	9	66448175	missense	probably benign	0.04
R0044:Herc1	UTSW	9	66448175	missense	probably benign	0.04
R0052:Herc1	UTSW	9	66400156	missense	probably damaging	0.99
R0114:Herc1	UTSW	9	66461846	missense	probably damaging	0.99
R0129:Herc1	UTSW	9	66448075	missense	probably damaging	1.00
R0131:Herc1	UTSW	9	66480910	missense	probably benign	0.00
R0131:Herc1	UTSW	9	66480910	missense	probably benign	0.00
R0132:Herc1	UTSW	9	66480910	missense	probably benign	0.00
R0158:Herc1	UTSW	9	66495921	nonsense	probably null
R0333:Herc1	UTSW	9	66464699	splice site	probably null
R0384:Herc1	UTSW	9	66481050	splice site	probably benign
R0419:Herc1	UTSW	9	66446074	splice site	probably benign
R0453:Herc1	UTSW	9	66399772	missense	probably benign	0.20
R0458:Herc1	UTSW	9	66476381	missense	probably benign	0.12
R0490:Herc1	UTSW	9	66484999	missense	probably damaging	1.00
R0506:Herc1	UTSW	9	66448159	missense	probably damaging	0.99
R0513:Herc1	UTSW	9	66445645	missense	possibly damaging	0.96
R0628:Herc1	UTSW	9	66450881	missense	probably benign	0.35
R0666:Herc1	UTSW	9	66484888	splice site	probably benign
R0674:Herc1	UTSW	9	66501192	missense	probably damaging	0.99
R0682:Herc1	UTSW	9	66481981	missense	possibly damaging	0.95
R0690:Herc1	UTSW	9	66386838	nonsense	probably null
R0701:Herc1	UTSW	9	66487950	missense	probably damaging	1.00
R0766:Herc1	UTSW	9	66504840	missense	probably damaging	1.00
R0850:Herc1	UTSW	9	66466670	missense	probably damaging	1.00
R0907:Herc1	UTSW	9	66433428	missense	possibly damaging	0.94
R0972:Herc1	UTSW	9	66372145	missense	probably damaging	1.00
R0976:Herc1	UTSW	9	66439878	missense	possibly damaging	0.74
R1027:Herc1	UTSW	9	66455968	missense	probably benign
R1200:Herc1	UTSW	9	66486124	missense	probably damaging	1.00
R1226:Herc1	UTSW	9	66416263	missense	probably benign	0.00
R1364:Herc1	UTSW	9	66400093	missense	probably damaging	1.00
R1395:Herc1	UTSW	9	66439181	missense	probably benign	0.13
R1432:Herc1	UTSW	9	66465469	missense	probably benign	0.13
R1440:Herc1	UTSW	9	66467803	missense	probably damaging	1.00
R1476:Herc1	UTSW	9	66508266	missense	probably damaging	1.00
R1590:Herc1	UTSW	9	66491953	splice site	probably benign
R1634:Herc1	UTSW	9	66473538	missense	possibly damaging	0.51
R1700:Herc1	UTSW	9	66450678	splice site	probably null
R1753:Herc1	UTSW	9	66469010	missense	probably damaging	1.00
R1753:Herc1	UTSW	9	66502084	critical splice donor site	probably null
R1796:Herc1	UTSW	9	66388856	nonsense	probably null
R1830:Herc1	UTSW	9	66497599	missense	possibly damaging	0.95
R1855:Herc1	UTSW	9	66391426	missense	possibly damaging	0.95
R1866:Herc1	UTSW	9	66450791	missense	probably damaging	1.00
R1894:Herc1	UTSW	9	66479461	missense	probably damaging	1.00
R1918:Herc1	UTSW	9	66476126	splice site	probably null
R1999:Herc1	UTSW	9	66486078	missense	probably benign	0.07
R2034:Herc1	UTSW	9	66441972	missense	probably benign	0.01
R2138:Herc1	UTSW	9	66470307	missense	possibly damaging	0.94
R2186:Herc1	UTSW	9	66439901	missense	probably benign	0.45
R2192:Herc1	UTSW	9	66465406	missense	probably damaging	0.99
R2312:Herc1	UTSW	9	66508281	nonsense	probably null
R2338:Herc1	UTSW	9	66428969	missense	possibly damaging	0.69
R3035:Herc1	UTSW	9	66483935	missense	possibly damaging	0.89
R3732:Herc1	UTSW	9	66445640	missense	probably damaging	1.00
R3732:Herc1	UTSW	9	66445640	missense	probably damaging	1.00
R3733:Herc1	UTSW	9	66445640	missense	probably damaging	1.00
R3917:Herc1	UTSW	9	66434466	missense	possibly damaging	0.94
R3953:Herc1	UTSW	9	66433793	nonsense	probably null
R4073:Herc1	UTSW	9	66418492	missense	probably benign	0.12
R4075:Herc1	UTSW	9	66418492	missense	probably benign	0.12
R4241:Herc1	UTSW	9	66448348	frame shift	probably null
R4260:Herc1	UTSW	9	66448348	frame shift	probably null
R4261:Herc1	UTSW	9	66448348	frame shift	probably null
R4300:Herc1	UTSW	9	66489406	missense	probably damaging	1.00
R4398:Herc1	UTSW	9	66479453	missense	probably benign	0.13
R4426:Herc1	UTSW	9	66496005	missense	probably damaging	1.00
R4427:Herc1	UTSW	9	66496005	missense	probably damaging	1.00
R4590:Herc1	UTSW	9	66437664	missense	probably damaging	0.97
R4630:Herc1	UTSW	9	66433714	splice site	probably null
R4656:Herc1	UTSW	9	66394711	missense	probably damaging	0.97
R4658:Herc1	UTSW	9	66479491	missense	possibly damaging	0.50
R4663:Herc1	UTSW	9	66433378	missense	probably damaging	0.98
R4675:Herc1	UTSW	9	66391458	missense	probably damaging	1.00
R4678:Herc1	UTSW	9	66416269	missense	probably benign	0.00
R4754:Herc1	UTSW	9	66501206	missense	probably benign	0.00
R4766:Herc1	UTSW	9	66441929	missense	probably benign	0.00
R4792:Herc1	UTSW	9	66495984	missense	possibly damaging	0.67
R4828:Herc1	UTSW	9	66497343	splice site	probably null
R4832:Herc1	UTSW	9	66495971	missense	probably benign	0.11
R4879:Herc1	UTSW	9	66462837	nonsense	probably null
R4948:Herc1	UTSW	9	66484902	missense	probably benign
R5021:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5022:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5023:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5024:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5025:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5026:Herc1	UTSW	9	66486126	missense	probably benign	0.03
R5027:Herc1	UTSW	9	66473529	missense	probably benign	0.01
R5027:Herc1	UTSW	9	66504618	missense	probably damaging	0.98
R5038:Herc1	UTSW	9	66476460	intron	probably benign
R5041:Herc1	UTSW	9	66429045	missense	possibly damaging	0.86
R5053:Herc1	UTSW	9	66470326	missense	possibly damaging	0.48
R5137:Herc1	UTSW	9	66448223	missense	probably benign
R5197:Herc1	UTSW	9	66448504	missense	probably damaging	0.99
R5207:Herc1	UTSW	9	66399869	nonsense	probably null
R5247:Herc1	UTSW	9	66434551	missense	probably benign	0.01
R5267:Herc1	UTSW	9	66461809	missense	probably damaging	1.00
R5274:Herc1	UTSW	9	66399409	missense	probably benign
R5375:Herc1	UTSW	9	66467887	missense	probably damaging	0.99
R5401:Herc1	UTSW	9	66502056	missense	probably damaging	1.00
R5560:Herc1	UTSW	9	66451119	missense	probably benign	0.02
R5566:Herc1	UTSW	9	66465537	missense	possibly damaging	0.95
R5577:Herc1	UTSW	9	66481981	missense	probably damaging	0.99
R5596:Herc1	UTSW	9	66434063	critical splice acceptor site	probably benign
R5665:Herc1	UTSW	9	66465435	missense	probably damaging	1.00
R5744:Herc1	UTSW	9	66508193	missense	probably damaging	1.00
R5802:Herc1	UTSW	9	66462878	missense	probably damaging	1.00
R5822:Herc1	UTSW	9	66445612	missense	probably benign	0.00
R5954:Herc1	UTSW	9	66451492	splice site	probably benign
R5977:Herc1	UTSW	9	66433322	missense	possibly damaging	0.77
R6022:Herc1	UTSW	9	66483685	missense	probably damaging	1.00
R6043:Herc1	UTSW	9	66408154	missense	probably benign
R6046:Herc1	UTSW	9	66445549	missense	probably damaging	0.99
R6089:Herc1	UTSW	9	66445532	missense	probably damaging	1.00
R6123:Herc1	UTSW	9	66497250	missense	probably damaging	0.97
R6155:Herc1	UTSW	9	66433423	missense	possibly damaging	0.95
R6190:Herc1	UTSW	9	66376381	missense	possibly damaging	0.56
R6220:Herc1	UTSW	9	66433788	missense	probably damaging	1.00
R6265:Herc1	UTSW	9	66372016	missense	probably benign	0.05
R6348:Herc1	UTSW	9	66487976	missense	possibly damaging	0.77
R6362:Herc1	UTSW	9	66471908	missense	probably damaging	1.00
R6394:Herc1	UTSW	9	66395059	missense	probably damaging	0.99
R6434:Herc1	UTSW	9	66486182	missense	probably damaging	0.99
R6483:Herc1	UTSW	9	66448529	missense	possibly damaging	0.64
R6607:Herc1	UTSW	9	66418567	missense	probably benign	0.02
R6633:Herc1	UTSW	9	66439252	nonsense	probably null
R6634:Herc1	UTSW	9	66437744	missense	probably benign
R6693:Herc1	UTSW	9	66478976	missense	probably damaging	0.99
R6695:Herc1	UTSW	9	66483866	splice site	probably null
R6748:Herc1	UTSW	9	66501188	frame shift	probably null
R6750:Herc1	UTSW	9	66501188	frame shift	probably null
R6751:Herc1	UTSW	9	66501188	frame shift	probably null
R6774:Herc1	UTSW	9	66501188	frame shift	probably null
R6785:Herc1	UTSW	9	66501188	frame shift	probably null
R6786:Herc1	UTSW	9	66501188	frame shift	probably null
R6856:Herc1	UTSW	9	66397898	missense	probably benign	0.05
R6966:Herc1	UTSW	9	66411065	missense	probably benign	0.07
R7020:Herc1	UTSW	9	66486078	missense	probably benign	0.07
R7109:Herc1	UTSW	9	66481889	missense	probably benign	0.03
R7122:Herc1	UTSW	9	66399774	missense	possibly damaging	0.69
R7209:Herc1	UTSW	9	66385032	missense	possibly damaging	0.95
R7222:Herc1	UTSW	9	66467499	missense	probably damaging	0.98
R7303:Herc1	UTSW	9	66450816	missense	possibly damaging	0.93
R7305:Herc1	UTSW	9	66461868	missense
R7438:Herc1	UTSW	9	66394756	missense	probably benign	0.00
R7535:Herc1	UTSW	9	66474853	missense	probably damaging	1.00
R7585:Herc1	UTSW	9	66445547	missense	probably damaging	1.00
R7603:Herc1	UTSW	9	66451383	nonsense	probably null
R7670:Herc1	UTSW	9	66416347	missense	probably damaging	0.99
R7705:Herc1	UTSW	9	66439834	missense	possibly damaging	0.86
R7723:Herc1	UTSW	9	66371876	missense	probably benign	0.24
R7730:Herc1	UTSW	9	66493190	small deletion	probably benign
R7880:Herc1	UTSW	9	66508224	missense	probably damaging	0.99
R7958:Herc1	UTSW	9	66486193	missense	probably damaging	1.00
R7976:Herc1	UTSW	9	66434270	missense	possibly damaging	0.94
R8006:Herc1	UTSW	9	66445560	nonsense	probably null
R8084:Herc1	UTSW	9	66475935	missense	probably benign	0.45
R8094:Herc1	UTSW	9	66493180	missense	probably damaging	0.98
R8099:Herc1	UTSW	9	66372140	missense	probably damaging	1.00
R8151:Herc1	UTSW	9	66433791	missense	probably damaging	0.98
R8159:Herc1	UTSW	9	66461721	missense	probably null
R8190:Herc1	UTSW	9	66418451	missense	probably benign	0.00
R8213:Herc1	UTSW	9	66450888	missense	probably damaging	0.99
R8230:Herc1	UTSW	9	66470316	missense	probably damaging	0.99
R8265:Herc1	UTSW	9	66386704	nonsense	probably null
R8270:Herc1	UTSW	9	66487950	missense	probably damaging	1.00
R8423:Herc1	UTSW	9	66508160	missense	probably damaging	0.99
R8506:Herc1	UTSW	9	66473581	missense	possibly damaging	0.52
R8523:Herc1	UTSW	9	66450942	missense	probably benign
R8530:Herc1	UTSW	9	66418628	missense	probably benign
R8545:Herc1	UTSW	9	66371975	nonsense	probably null
R8682:Herc1	UTSW	9	66462848	missense
R8720:Herc1	UTSW	9	66481823	missense	probably benign	0.38
R8792:Herc1	UTSW	9	66465486	missense	probably damaging	1.00
RF023:Herc1	UTSW	9	66458334	missense
X0011:Herc1	UTSW	9	66400159	missense	probably benign	0.28
X0067:Herc1	UTSW	9	66448524	missense	probably benign	0.03
Z1176:Herc1	UTSW	9	66434576	missense	probably benign
Z1177:Herc1	UTSW	9	66458425	missense	probably null
Z1177:Herc1	UTSW	9	66471911	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTGGGTGGTAATGAGTAGCCC -3'
(R):5'- TGAAGTAACTAAATGTGGCCACTG -3'

Sequencing Primer
(F):5'- GCAGTGCACTTGTTAACAGC -3'
(R):5'- AAATGTGGCCACTGTTTGTATCAGC -3'

Posted On

2021-01-18