Incidental Mutation 'R8353:Fbxl6'
ID 660561
Institutional Source Beutler Lab
Gene Symbol Fbxl6
Ensembl Gene ENSMUSG00000022559
Gene Name F-box and leucine-rich repeat protein 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R8353 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 76535721-76538746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 76538478 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 80 (T80K)
Ref Sequence ENSEMBL: ENSMUSP00000023219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]
AlphaFold Q9QXW0
Predicted Effect probably benign
Transcript: ENSMUST00000023219
AA Change: T80K

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559
AA Change: T80K

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 58 77 N/A INTRINSIC
Pfam:F-box 104 154 3.1e-6 PFAM
Pfam:F-box-like 105 155 1.8e-13 PFAM
low complexity region 163 174 N/A INTRINSIC
SCOP:d1yrga_ 184 448 3e-9 SMART
Blast:LRR 211 236 2e-6 BLAST
Blast:LRR 347 373 6e-8 BLAST
Blast:LRR 375 405 7e-9 BLAST
Blast:LRR 432 456 7e-6 BLAST
Blast:LRR 464 488 1e-5 BLAST
Blast:LRR 489 520 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023220
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230604
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T A 16: 14,038,013 probably null Het
9930021J03Rik T C 19: 29,753,842 H590R possibly damaging Het
Abr T C 11: 76,419,833 T752A probably damaging Het
Adar A G 3: 89,750,262 T508A possibly damaging Het
Atxn3 T A 12: 101,945,900 K85I probably benign Het
Atxn7l1 G T 12: 33,147,883 W50L probably damaging Het
Bahcc1 T C 11: 120,274,425 V894A probably damaging Het
Bloc1s3 G T 7: 19,507,399 T68K probably benign Het
C130073F10Rik C T 4: 101,890,684 probably null Het
C330027C09Rik C T 16: 49,001,073 Q181* probably null Het
Cd55b T C 1: 130,414,133 I256V probably benign Het
Celsr3 T A 9: 108,826,535 D72E probably benign Het
Cep41 T C 6: 30,658,892 D152G probably benign Het
Cpne8 C A 15: 90,541,293 K285N possibly damaging Het
Csmd3 A T 15: 47,949,953 I1061K probably damaging Het
Cspg4 A T 9: 56,898,669 N2255Y probably damaging Het
Cym T A 3: 107,221,709 probably benign Het
Cyp2d9 T C 15: 82,452,519 V23A probably damaging Het
Dnah1 A T 14: 31,283,202 I2365K probably benign Het
Dock5 C T 14: 67,817,508 probably null Het
Dopey1 A T 9: 86,521,586 H1613L probably damaging Het
Dusp5 T C 19: 53,529,682 V122A possibly damaging Het
Emc6 A G 11: 73,176,573 L44P probably damaging Het
Frrs1 T A 3: 116,899,173 M32K possibly damaging Het
Gfod1 A G 13: 43,200,890 V203A possibly damaging Het
Gjc2 G A 11: 59,177,014 A214V unknown Het
Gkn2 T C 6: 87,378,153 Y115H probably damaging Het
Gpatch1 A C 7: 35,277,279 probably benign Het
Hemgn G T 4: 46,403,935 P20Q possibly damaging Het
Herc1 G T 9: 66,508,289 V4849L possibly damaging Het
Hmcn2 A T 2: 31,385,341 probably null Het
Htt C A 5: 34,877,155 T1990N possibly damaging Het
Jrk C T 15: 74,706,625 W270* probably null Het
Katnb1 A G 8: 95,095,444 D266G probably damaging Het
Klhl42 A G 6: 147,107,923 K420R probably damaging Het
Lamb1 C A 12: 31,306,999 T1035K probably damaging Het
Laptm5 T C 4: 130,928,768 probably null Het
Lilra5 T C 7: 4,237,972 S22P probably benign Het
Mn1 A G 5: 111,420,639 N825S possibly damaging Het
Mup17 C T 4: 61,592,182 probably null Het
Ncapd3 T A 9: 27,071,804 D949E probably benign Het
Ncoa7 T C 10: 30,694,159 E230G probably damaging Het
Nxnl1 A G 8: 71,562,868 V132A probably damaging Het
Oard1 A G 17: 48,416,760 I145V probably benign Het
Pabpc4 T G 4: 123,296,053 L555R probably benign Het
Ppp1r11 G T 17: 36,949,974 S21R possibly damaging Het
Prr36 T C 8: 4,213,831 probably benign Het
Serpina1a T A 12: 103,855,779 D298V probably benign Het
Sqle A T 15: 59,324,465 H369L possibly damaging Het
Stambp T C 6: 83,561,899 E173G probably damaging Het
Syne1 T C 10: 5,350,983 N915S probably damaging Het
Tjap1 C A 17: 46,282,604 probably benign Het
Tmem62 A C 2: 120,984,336 K30T probably damaging Het
Tmtc1 T C 6: 148,425,848 T56A probably benign Het
Trav6-4 A T 14: 53,454,489 M18L probably benign Het
Trim69 T C 2: 122,168,009 I154T possibly damaging Het
Uggt1 T C 1: 36,170,296 probably null Het
Usp48 T A 4: 137,623,382 M60K probably benign Het
Usp7 A G 16: 8,695,871 S753P probably benign Het
Vmn2r27 A C 6: 124,192,445 N575K probably damaging Het
Wdfy4 A C 14: 32,973,624 D2672E probably benign Het
Zdhhc17 G A 10: 111,009,942 P30L probably benign Het
Zmym4 T A 4: 126,907,112 Y565F possibly damaging Het
Other mutations in Fbxl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Fbxl6 APN 15 76535906 nonsense probably null
IGL02205:Fbxl6 APN 15 76537341 missense probably benign 0.05
R0244:Fbxl6 UTSW 15 76537191 missense probably damaging 1.00
R0449:Fbxl6 UTSW 15 76535955 missense probably damaging 1.00
R0608:Fbxl6 UTSW 15 76536753 missense probably benign 0.04
R0904:Fbxl6 UTSW 15 76537083 splice site probably null
R1477:Fbxl6 UTSW 15 76537734 missense probably benign
R1784:Fbxl6 UTSW 15 76538058 missense probably damaging 1.00
R2109:Fbxl6 UTSW 15 76536973 missense probably damaging 0.99
R3937:Fbxl6 UTSW 15 76536624 nonsense probably null
R4414:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4416:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4483:Fbxl6 UTSW 15 76537929 missense probably damaging 1.00
R4835:Fbxl6 UTSW 15 76536804 missense probably damaging 1.00
R6175:Fbxl6 UTSW 15 76538433 missense probably benign
R6345:Fbxl6 UTSW 15 76535854 missense probably damaging 1.00
R6750:Fbxl6 UTSW 15 76538412 missense probably damaging 1.00
R6800:Fbxl6 UTSW 15 76538698 unclassified probably benign
R7485:Fbxl6 UTSW 15 76537913 splice site probably null
R7560:Fbxl6 UTSW 15 76538469 missense probably benign 0.06
R7726:Fbxl6 UTSW 15 76535886 missense probably damaging 1.00
R7811:Fbxl6 UTSW 15 76537285 splice site probably null
R8548:Fbxl6 UTSW 15 76537342 missense possibly damaging 0.65
X0058:Fbxl6 UTSW 15 76538476 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CTAAGTGAAGACAGGTGCCG -3'
(R):5'- TCGAGTTCGAAGCTCCAAG -3'

Sequencing Primer
(F):5'- TTCGCCCGATGTGATGC -3'
(R):5'- CTCCAAGCGGCCCGATG -3'
Posted On 2021-01-18