Incidental Mutation 'R8353:Ppp1r11'
ID660566
Institutional Source Beutler Lab
Gene Symbol Ppp1r11
Ensembl Gene ENSMUSG00000036398
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 11
SynonymsTctex-5, HCGV, Tctex5, 1500041B02Rik, Tcte5, HCG-V
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R8353 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location36948356-36951741 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36949974 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 21 (S21R)
Ref Sequence ENSEMBL: ENSMUSP00000134322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040402] [ENSMUST00000040498] [ENSMUST00000113669] [ENSMUST00000172518] [ENSMUST00000172823] [ENSMUST00000173072] [ENSMUST00000173540] [ENSMUST00000174669] [ENSMUST00000174711]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040402
AA Change: S32R

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000047202
Gene: ENSMUSG00000036398
AA Change: S32R

DomainStartEndE-ValueType
Pfam:PPI_Ypi1 22 87 8.7e-26 PFAM
low complexity region 105 128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040498
SMART Domains Protein: ENSMUSP00000037860
Gene: ENSMUSG00000036492

DomainStartEndE-ValueType
RING 20 66 3.47e-4 SMART
low complexity region 99 109 N/A INTRINSIC
PRY 159 212 6.23e-15 SMART
Blast:SPRY 213 349 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000113669
SMART Domains Protein: ENSMUSP00000109299
Gene: ENSMUSG00000036315

DomainStartEndE-ValueType
ZnF_C2C2 82 121 1.68e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172518
SMART Domains Protein: ENSMUSP00000133651
Gene: ENSMUSG00000036315

DomainStartEndE-ValueType
ZnF_C2C2 82 121 1.68e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172823
SMART Domains Protein: ENSMUSP00000133644
Gene: ENSMUSG00000036315

DomainStartEndE-ValueType
ZnF_C2C2 59 98 1.68e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173072
SMART Domains Protein: ENSMUSP00000133710
Gene: ENSMUSG00000036492

DomainStartEndE-ValueType
RING 20 66 3.47e-4 SMART
low complexity region 99 109 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173540
AA Change: S21R

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134322
Gene: ENSMUSG00000036398
AA Change: S21R

DomainStartEndE-ValueType
Pfam:PPI_Ypi1 5 77 2e-24 PFAM
low complexity region 94 117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174669
SMART Domains Protein: ENSMUSP00000134113
Gene: ENSMUSG00000036492

DomainStartEndE-ValueType
PRY 37 90 6.23e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000174711
AA Change: S32R

PolyPhen 2 Score 0.728 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134685
Gene: ENSMUSG00000036398
AA Change: S32R

DomainStartEndE-ValueType
Pfam:PPI_Ypi1 22 87 8.7e-26 PFAM
low complexity region 105 128 N/A INTRINSIC
Meta Mutation Damage Score 0.0877 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a specific inhibitor of protein phosphatase-1 (PP1) with a differential sensitivity toward the metal-independent and metal-dependent forms of PP1. The gene is located within the major histocompatibility complex class I region on chromosome 6. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900011O08Rik T A 16: 14,038,013 probably null Het
9930021J03Rik T C 19: 29,753,842 H590R possibly damaging Het
Abr T C 11: 76,419,833 T752A probably damaging Het
Adar A G 3: 89,750,262 T508A possibly damaging Het
Atxn3 T A 12: 101,945,900 K85I probably benign Het
Atxn7l1 G T 12: 33,147,883 W50L probably damaging Het
Bahcc1 T C 11: 120,274,425 V894A probably damaging Het
Bloc1s3 G T 7: 19,507,399 T68K probably benign Het
C130073F10Rik C T 4: 101,890,684 probably null Het
C330027C09Rik C T 16: 49,001,073 Q181* probably null Het
Cd55b T C 1: 130,414,133 I256V probably benign Het
Celsr3 T A 9: 108,826,535 D72E probably benign Het
Cep41 T C 6: 30,658,892 D152G probably benign Het
Cpne8 C A 15: 90,541,293 K285N possibly damaging Het
Csmd3 A T 15: 47,949,953 I1061K probably damaging Het
Cspg4 A T 9: 56,898,669 N2255Y probably damaging Het
Cym T A 3: 107,221,709 probably benign Het
Cyp2d9 T C 15: 82,452,519 V23A probably damaging Het
Dnah1 A T 14: 31,283,202 I2365K probably benign Het
Dock5 C T 14: 67,817,508 probably null Het
Dopey1 A T 9: 86,521,586 H1613L probably damaging Het
Dusp5 T C 19: 53,529,682 V122A possibly damaging Het
Emc6 A G 11: 73,176,573 L44P probably damaging Het
Fbxl6 G T 15: 76,538,478 T80K probably benign Het
Frrs1 T A 3: 116,899,173 M32K possibly damaging Het
Gfod1 A G 13: 43,200,890 V203A possibly damaging Het
Gjc2 G A 11: 59,177,014 A214V unknown Het
Gkn2 T C 6: 87,378,153 Y115H probably damaging Het
Gpatch1 A C 7: 35,277,279 probably benign Het
Hemgn G T 4: 46,403,935 P20Q possibly damaging Het
Herc1 G T 9: 66,508,289 V4849L possibly damaging Het
Hmcn2 A T 2: 31,385,341 probably null Het
Htt C A 5: 34,877,155 T1990N possibly damaging Het
Jrk C T 15: 74,706,625 W270* probably null Het
Katnb1 A G 8: 95,095,444 D266G probably damaging Het
Klhl42 A G 6: 147,107,923 K420R probably damaging Het
Lamb1 C A 12: 31,306,999 T1035K probably damaging Het
Laptm5 T C 4: 130,928,768 probably null Het
Lilra5 T C 7: 4,237,972 S22P probably benign Het
Mn1 A G 5: 111,420,639 N825S possibly damaging Het
Mup17 C T 4: 61,592,182 probably null Het
Ncapd3 T A 9: 27,071,804 D949E probably benign Het
Ncoa7 T C 10: 30,694,159 E230G probably damaging Het
Nxnl1 A G 8: 71,562,868 V132A probably damaging Het
Oard1 A G 17: 48,416,760 I145V probably benign Het
Pabpc4 T G 4: 123,296,053 L555R probably benign Het
Prr36 T C 8: 4,213,831 probably benign Het
Serpina1a T A 12: 103,855,779 D298V probably benign Het
Sqle A T 15: 59,324,465 H369L possibly damaging Het
Stambp T C 6: 83,561,899 E173G probably damaging Het
Syne1 T C 10: 5,350,983 N915S probably damaging Het
Tjap1 C A 17: 46,282,604 probably benign Het
Tmem62 A C 2: 120,984,336 K30T probably damaging Het
Tmtc1 T C 6: 148,425,848 T56A probably benign Het
Trav6-4 A T 14: 53,454,489 M18L probably benign Het
Trim69 T C 2: 122,168,009 I154T possibly damaging Het
Uggt1 T C 1: 36,170,296 probably null Het
Usp48 T A 4: 137,623,382 M60K probably benign Het
Usp7 A G 16: 8,695,871 S753P probably benign Het
Vmn2r27 A C 6: 124,192,445 N575K probably damaging Het
Wdfy4 A C 14: 32,973,624 D2672E probably benign Het
Zdhhc17 G A 10: 111,009,942 P30L probably benign Het
Zmym4 T A 4: 126,907,112 Y565F possibly damaging Het
Other mutations in Ppp1r11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02584:Ppp1r11 APN 17 36949889 missense probably damaging 1.00
R5613:Ppp1r11 UTSW 17 36951488 missense probably damaging 1.00
R7327:Ppp1r11 UTSW 17 36951008 missense possibly damaging 0.82
R8039:Ppp1r11 UTSW 17 36951446 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTAACTCCAGGCAGTTGGTAC -3'
(R):5'- GAACAGGGATTCATACTCTCCAC -3'

Sequencing Primer
(F):5'- CAGGCAGTTGGTACCGCATAG -3'
(R):5'- GGGATTCATACTCTCCACAAACAGG -3'
Posted On2021-01-18