Incidental Mutation 'R8354:St5'
ID 660601
Institutional Source Beutler Lab
Gene Symbol St5
Ensembl Gene ENSMUSG00000031024
Gene Name suppression of tumorigenicity 5
Synonyms 2610305K15Rik, 2010004M01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R8354 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 109523911-109703605 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 109525548 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 675 (R675*)
Ref Sequence ENSEMBL: ENSMUSP00000130119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000143107] [ENSMUST00000156921] [ENSMUST00000168005]
AlphaFold Q924W7
Predicted Effect probably null
Transcript: ENSMUST00000077909
AA Change: R1092*
SMART Domains Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: R1092*

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000079282
AA Change: R1092*
SMART Domains Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: R1092*

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
low complexity region 197 213 N/A INTRINSIC
low complexity region 314 326 N/A INTRINSIC
low complexity region 327 348 N/A INTRINSIC
low complexity region 365 379 N/A INTRINSIC
low complexity region 407 426 N/A INTRINSIC
low complexity region 577 609 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
low complexity region 645 656 N/A INTRINSIC
uDENN 690 781 1.16e-30 SMART
DENN 788 972 7.84e-78 SMART
low complexity region 1007 1014 N/A INTRINSIC
dDENN 1019 1086 3.12e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000084738
AA Change: R675*
SMART Domains Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: R675*

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143107
SMART Domains Protein: ENSMUSP00000123410
Gene: ENSMUSG00000046364

DomainStartEndE-ValueType
Pfam:Ribosomal_L18e 26 146 7.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156921
Predicted Effect probably null
Transcript: ENSMUST00000168005
AA Change: R675*
SMART Domains Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: R675*

DomainStartEndE-ValueType
low complexity region 160 192 N/A INTRINSIC
low complexity region 207 221 N/A INTRINSIC
low complexity region 228 239 N/A INTRINSIC
uDENN 273 364 1.16e-30 SMART
DENN 371 555 7.84e-78 SMART
low complexity region 590 597 N/A INTRINSIC
dDENN 602 669 3.12e-22 SMART
Meta Mutation Damage Score 0.9756 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,834,377 S353R probably damaging Het
Ap1ar T C 3: 127,812,779 probably null Het
Asxl1 C A 2: 153,393,425 N213K probably benign Het
Cacna1e A G 1: 154,398,568 V2197A probably damaging Het
Cacna2d2 G A 9: 107,524,135 E706K possibly damaging Het
Cfap46 C T 7: 139,653,498 V296I probably benign Het
Cldn5 A G 16: 18,777,293 T100A probably benign Het
Ctnna1 C A 18: 35,252,723 N802K possibly damaging Het
Dip2c A G 13: 9,621,882 T968A probably benign Het
Dnaaf5 ACCCAGCACCTGGAGATCGTCC ACC 5: 139,161,859 probably null Het
Dnah8 A T 17: 30,643,260 D203V probably benign Het
Dnajc13 A G 9: 104,217,728 M585T probably damaging Het
Donson G T 16: 91,683,797 T262K possibly damaging Het
E2f3 T A 13: 29,985,804 probably benign Het
Fam110c A G 12: 31,075,179 E380G possibly damaging Het
Gbp9 T G 5: 105,094,161 T177P probably damaging Het
Gins3 C T 8: 95,638,018 A132V probably benign Het
Glra3 T A 8: 56,125,310 Y467* probably null Het
Gm12394 T A 4: 42,793,223 H303L probably benign Het
Gm7138 A G 10: 77,776,610 probably benign Het
Golim4 T C 3: 75,895,001 E328G probably damaging Het
Habp2 T A 19: 56,312,956 C270* probably null Het
Hecw2 A G 1: 53,925,308 probably null Het
Hmcn1 A T 1: 150,758,391 Y815N possibly damaging Het
Igfn1 A T 1: 135,959,881 C2482S possibly damaging Het
Igkv4-71 A G 6: 69,243,276 V57A probably damaging Het
Itpkb G A 1: 180,333,343 E345K possibly damaging Het
Itpr3 G A 17: 27,115,919 V2136M possibly damaging Het
Kcnh3 A G 15: 99,229,330 T336A probably damaging Het
Kdm4d T C 9: 14,463,939 T208A possibly damaging Het
Kntc1 T C 5: 123,778,267 F721S probably damaging Het
Krt10 A G 11: 99,389,260 probably benign Het
Lgals3bp T A 11: 118,398,541 N28I probably damaging Het
Matn2 T C 15: 34,378,697 L293P probably damaging Het
Mical3 T C 6: 120,973,420 E1010G probably damaging Het
Mpp4 C A 1: 59,130,065 R380L probably damaging Het
Msh5 A G 17: 35,031,766 F469L possibly damaging Het
Ncam2 A G 16: 81,512,959 T446A probably benign Het
Neurl4 A G 11: 69,909,236 D1050G probably damaging Het
Olfml2b T C 1: 170,682,224 Y714H possibly damaging Het
Olfr1173 T C 2: 88,274,692 D119G probably damaging Het
Olfr895 T C 9: 38,269,217 S235P probably benign Het
Pcnx2 T C 8: 125,761,618 E1729G probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pex1 T A 5: 3,631,707 L1051Q probably damaging Het
Prkag2 T A 5: 24,869,139 R283* probably null Het
Prrc1 T A 18: 57,371,431 M238K probably damaging Het
Ptprj T C 2: 90,469,717 T247A probably benign Het
Ptprz1 A G 6: 22,999,615 Y568C probably damaging Het
Rab36 G A 10: 75,048,459 A114T probably damaging Het
Rfx7 T C 9: 72,619,449 V1307A probably benign Het
Scaf1 A C 7: 45,007,827 probably benign Het
Sema4g A T 19: 44,998,427 T440S probably benign Het
Setbp1 A T 18: 78,857,383 V1023E probably damaging Het
Slc46a2 T C 4: 59,913,931 I331V possibly damaging Het
Slc4a7 C T 14: 14,786,313 R1000C probably damaging Het
Sorcs2 T C 5: 36,065,409 H162R probably benign Het
Strip2 G A 6: 29,920,532 probably null Het
Stx2 T A 5: 128,994,868 I42L probably benign Het
Tas2r124 A T 6: 132,755,447 T240S probably benign Het
Tgfbrap1 A T 1: 43,075,910 V10D probably damaging Het
Tmem41a T A 16: 21,947,431 Y19F probably benign Het
Tmprss5 A G 9: 49,107,139 T74A possibly damaging Het
Trim16 G T 11: 62,836,761 R216L probably benign Het
Trmt10c T C 16: 56,034,507 K255R probably benign Het
Trpm2 A T 10: 77,933,649 V747E probably damaging Het
Ube2v2 T C 16: 15,581,141 D28G possibly damaging Het
Uty G A Y: 1,157,928 T705I possibly damaging Het
Vmn2r80 A T 10: 79,148,876 I21F probably benign Het
Wdr11 T C 7: 129,602,999 L176S probably damaging Het
Zfp992 A G 4: 146,466,862 T347A probably benign Het
Other mutations in St5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:St5 APN 7 109527708 missense possibly damaging 0.71
IGL01132:St5 APN 7 109570005 splice site probably null
IGL01288:St5 APN 7 109539822 missense probably damaging 0.96
IGL01645:St5 APN 7 109527634 nonsense probably null
IGL01714:St5 APN 7 109570062 missense probably damaging 0.99
IGL02021:St5 APN 7 109557372 missense probably damaging 1.00
IGL02302:St5 APN 7 109525331 missense probably damaging 1.00
IGL02496:St5 APN 7 109556235 missense possibly damaging 0.83
IGL02795:St5 APN 7 109556364 missense probably damaging 1.00
Bucolic UTSW 7 109525548 nonsense probably null
Halcyon UTSW 7 109556793 nonsense probably null
FR4340:St5 UTSW 7 109556921 unclassified probably benign
FR4737:St5 UTSW 7 109556921 unclassified probably benign
PIT4466001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4469001:St5 UTSW 7 109531130 missense probably damaging 1.00
PIT4472001:St5 UTSW 7 109531130 missense probably damaging 1.00
R0024:St5 UTSW 7 109524659 missense probably damaging 1.00
R0124:St5 UTSW 7 109542511 missense possibly damaging 0.66
R0125:St5 UTSW 7 109556338 missense probably benign 0.19
R0365:St5 UTSW 7 109538949 missense probably damaging 1.00
R0491:St5 UTSW 7 109557204 missense probably benign 0.45
R0534:St5 UTSW 7 109541428 missense probably damaging 1.00
R0662:St5 UTSW 7 109557426 missense probably damaging 1.00
R0743:St5 UTSW 7 109557345 missense probably damaging 1.00
R0772:St5 UTSW 7 109542320 splice site probably null
R0774:St5 UTSW 7 109542320 splice site probably null
R0787:St5 UTSW 7 109525620 missense possibly damaging 0.94
R0884:St5 UTSW 7 109557345 missense probably damaging 1.00
R1518:St5 UTSW 7 109557355 missense probably damaging 1.00
R1908:St5 UTSW 7 109525326 nonsense probably null
R1909:St5 UTSW 7 109525326 nonsense probably null
R2232:St5 UTSW 7 109557207 missense probably benign
R2358:St5 UTSW 7 109556446 missense probably benign 0.01
R2847:St5 UTSW 7 109525337 missense probably damaging 1.00
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2869:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2870:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2871:St5 UTSW 7 109557430 missense probably benign 0.01
R2873:St5 UTSW 7 109557430 missense probably benign 0.01
R2874:St5 UTSW 7 109557430 missense probably benign 0.01
R4534:St5 UTSW 7 109531156 missense probably damaging 1.00
R4536:St5 UTSW 7 109531156 missense probably damaging 1.00
R4559:St5 UTSW 7 109525578 missense probably damaging 1.00
R4798:St5 UTSW 7 109557033 missense probably damaging 0.99
R4846:St5 UTSW 7 109556836 nonsense probably null
R5110:St5 UTSW 7 109542490 missense probably benign 0.02
R5181:St5 UTSW 7 109556790 missense probably benign
R5268:St5 UTSW 7 109557312 missense probably benign
R5403:St5 UTSW 7 109556905 missense probably damaging 1.00
R5836:St5 UTSW 7 109541345 missense possibly damaging 0.78
R5932:St5 UTSW 7 109570016 missense probably damaging 1.00
R5937:St5 UTSW 7 109557271 missense possibly damaging 0.86
R6180:St5 UTSW 7 109556888 missense probably benign 0.11
R6741:St5 UTSW 7 109545097 missense possibly damaging 0.95
R6781:St5 UTSW 7 109525304 missense possibly damaging 0.83
R7086:St5 UTSW 7 109525574 missense probably damaging 1.00
R7466:St5 UTSW 7 109525346 missense probably damaging 1.00
R7644:St5 UTSW 7 109556793 nonsense probably null
R8745:St5 UTSW 7 109557072 missense probably benign 0.02
R8859:St5 UTSW 7 109524656 missense probably damaging 1.00
R9016:St5 UTSW 7 109540435 missense possibly damaging 0.84
R9178:St5 UTSW 7 109557084 missense probably benign 0.31
R9361:St5 UTSW 7 109527784 missense probably damaging 1.00
R9564:St5 UTSW 7 109526329 missense probably damaging 1.00
R9595:St5 UTSW 7 109556766 missense probably damaging 0.96
RF062:St5 UTSW 7 109556946 unclassified probably benign
X0067:St5 UTSW 7 109556240 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCACTCTCTGCTCAAAGAGGC -3'
(R):5'- TGGAGACTGTGGGTCACTAC -3'

Sequencing Primer
(F):5'- TCTCTGCTCAAAGAGGCCTGAG -3'
(R):5'- AGACTGTGGGTCACTACTCCCTC -3'
Posted On 2021-01-18