Incidental Mutation 'R8354:Dnajc13'
ID 660611
Institutional Source Beutler Lab
Gene Symbol Dnajc13
Ensembl Gene ENSMUSG00000032560
Gene Name DnaJ heat shock protein family (Hsp40) member C13
Synonyms LOC382100, D030002L11Rik, Rme8
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock # R8354 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 104151282-104262930 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104217728 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Threonine at position 585 (M585T)
Ref Sequence ENSEMBL: ENSMUSP00000139804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]
AlphaFold D4AFX7
Predicted Effect probably damaging
Transcript: ENSMUST00000035170
AA Change: M585T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: M585T

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
Blast:ARM 927 963 6e-12 BLAST
Pfam:DUF4339 976 1020 1.5e-18 PFAM
Blast:ARM 1071 1110 5e-12 BLAST
DnaJ 1300 1358 5.69e-18 SMART
low complexity region 1417 1426 N/A INTRINSIC
low complexity region 1813 1829 N/A INTRINSIC
Blast:ARM 1843 1884 6e-8 BLAST
low complexity region 1968 1984 N/A INTRINSIC
low complexity region 2006 2016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186788
AA Change: M585T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: M585T

DomainStartEndE-ValueType
low complexity region 706 719 N/A INTRINSIC
low complexity region 837 848 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
Blast:ARM 932 968 6e-12 BLAST
Pfam:DUF4339 980 1025 8.1e-14 PFAM
Blast:ARM 1076 1115 5e-12 BLAST
DnaJ 1305 1363 5.69e-18 SMART
low complexity region 1422 1431 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
Blast:ARM 1848 1889 6e-8 BLAST
low complexity region 1973 1989 N/A INTRINSIC
low complexity region 2011 2021 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,834,377 S353R probably damaging Het
Ap1ar T C 3: 127,812,779 probably null Het
Asxl1 C A 2: 153,393,425 N213K probably benign Het
Cacna1e A G 1: 154,398,568 V2197A probably damaging Het
Cacna2d2 G A 9: 107,524,135 E706K possibly damaging Het
Cfap46 C T 7: 139,653,498 V296I probably benign Het
Cldn5 A G 16: 18,777,293 T100A probably benign Het
Ctnna1 C A 18: 35,252,723 N802K possibly damaging Het
Dip2c A G 13: 9,621,882 T968A probably benign Het
Dnaaf5 ACCCAGCACCTGGAGATCGTCC ACC 5: 139,161,859 probably null Het
Dnah8 A T 17: 30,643,260 D203V probably benign Het
Donson G T 16: 91,683,797 T262K possibly damaging Het
E2f3 T A 13: 29,985,804 probably benign Het
Fam110c A G 12: 31,075,179 E380G possibly damaging Het
Gbp9 T G 5: 105,094,161 T177P probably damaging Het
Gins3 C T 8: 95,638,018 A132V probably benign Het
Glra3 T A 8: 56,125,310 Y467* probably null Het
Gm12394 T A 4: 42,793,223 H303L probably benign Het
Gm7138 A G 10: 77,776,610 probably benign Het
Golim4 T C 3: 75,895,001 E328G probably damaging Het
Habp2 T A 19: 56,312,956 C270* probably null Het
Hecw2 A G 1: 53,925,308 probably null Het
Hmcn1 A T 1: 150,758,391 Y815N possibly damaging Het
Igfn1 A T 1: 135,959,881 C2482S possibly damaging Het
Igkv4-71 A G 6: 69,243,276 V57A probably damaging Het
Itpkb G A 1: 180,333,343 E345K possibly damaging Het
Itpr3 G A 17: 27,115,919 V2136M possibly damaging Het
Kcnh3 A G 15: 99,229,330 T336A probably damaging Het
Kdm4d T C 9: 14,463,939 T208A possibly damaging Het
Kntc1 T C 5: 123,778,267 F721S probably damaging Het
Krt10 A G 11: 99,389,260 probably benign Het
Lgals3bp T A 11: 118,398,541 N28I probably damaging Het
Matn2 T C 15: 34,378,697 L293P probably damaging Het
Mical3 T C 6: 120,973,420 E1010G probably damaging Het
Mpp4 C A 1: 59,130,065 R380L probably damaging Het
Msh5 A G 17: 35,031,766 F469L possibly damaging Het
Ncam2 A G 16: 81,512,959 T446A probably benign Het
Neurl4 A G 11: 69,909,236 D1050G probably damaging Het
Olfml2b T C 1: 170,682,224 Y714H possibly damaging Het
Olfr1173 T C 2: 88,274,692 D119G probably damaging Het
Olfr895 T C 9: 38,269,217 S235P probably benign Het
Pcnx2 T C 8: 125,761,618 E1729G probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pex1 T A 5: 3,631,707 L1051Q probably damaging Het
Prkag2 T A 5: 24,869,139 R283* probably null Het
Prrc1 T A 18: 57,371,431 M238K probably damaging Het
Ptprj T C 2: 90,469,717 T247A probably benign Het
Ptprz1 A G 6: 22,999,615 Y568C probably damaging Het
Rab36 G A 10: 75,048,459 A114T probably damaging Het
Rfx7 T C 9: 72,619,449 V1307A probably benign Het
Scaf1 A C 7: 45,007,827 probably benign Het
Sema4g A T 19: 44,998,427 T440S probably benign Het
Setbp1 A T 18: 78,857,383 V1023E probably damaging Het
Slc46a2 T C 4: 59,913,931 I331V possibly damaging Het
Slc4a7 C T 14: 14,786,313 R1000C probably damaging Het
Sorcs2 T C 5: 36,065,409 H162R probably benign Het
St5 G A 7: 109,525,548 R675* probably null Het
Strip2 G A 6: 29,920,532 probably null Het
Stx2 T A 5: 128,994,868 I42L probably benign Het
Tas2r124 A T 6: 132,755,447 T240S probably benign Het
Tgfbrap1 A T 1: 43,075,910 V10D probably damaging Het
Tmem41a T A 16: 21,947,431 Y19F probably benign Het
Tmprss5 A G 9: 49,107,139 T74A possibly damaging Het
Trim16 G T 11: 62,836,761 R216L probably benign Het
Trmt10c T C 16: 56,034,507 K255R probably benign Het
Trpm2 A T 10: 77,933,649 V747E probably damaging Het
Ube2v2 T C 16: 15,581,141 D28G possibly damaging Het
Uty G A Y: 1,157,928 T705I possibly damaging Het
Vmn2r80 A T 10: 79,148,876 I21F probably benign Het
Wdr11 T C 7: 129,602,999 L176S probably damaging Het
Zfp992 A G 4: 146,466,862 T347A probably benign Het
Other mutations in Dnajc13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Dnajc13 APN 9 104162780 missense probably benign 0.15
IGL00754:Dnajc13 APN 9 104174498 nonsense probably null
IGL00914:Dnajc13 APN 9 104212882 missense possibly damaging 0.90
IGL01014:Dnajc13 APN 9 104203218 missense probably damaging 1.00
IGL01077:Dnajc13 APN 9 104231021 missense probably benign 0.11
IGL01137:Dnajc13 APN 9 104160490 missense probably benign
IGL01305:Dnajc13 APN 9 104230637 splice site probably null
IGL01707:Dnajc13 APN 9 104228979 missense probably damaging 1.00
IGL01781:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL01868:Dnajc13 APN 9 104162745 missense possibly damaging 0.83
IGL01950:Dnajc13 APN 9 104190432 missense possibly damaging 0.85
IGL02102:Dnajc13 APN 9 104229009 missense possibly damaging 0.78
IGL02350:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02357:Dnajc13 APN 9 104162359 missense possibly damaging 0.82
IGL02470:Dnajc13 APN 9 104175747 missense probably benign 0.17
IGL02888:Dnajc13 APN 9 104180062 splice site probably benign
IGL03079:Dnajc13 APN 9 104212869 nonsense probably null
IGL03179:Dnajc13 APN 9 104167435 missense probably benign 0.42
IGL03293:Dnajc13 APN 9 104174426 missense possibly damaging 0.64
impressario UTSW 9 104213886 missense probably benign 0.12
Kaiser UTSW 9 104214188 missense probably damaging 1.00
BB008:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
BB018:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
PIT4142001:Dnajc13 UTSW 9 104238473 missense probably damaging 0.96
R0323:Dnajc13 UTSW 9 104156892 missense probably damaging 1.00
R0361:Dnajc13 UTSW 9 104167059 missense probably benign 0.18
R0480:Dnajc13 UTSW 9 104200509 missense probably damaging 0.98
R0558:Dnajc13 UTSW 9 104201952 critical splice acceptor site probably null
R0707:Dnajc13 UTSW 9 104172582 missense probably benign 0.12
R0831:Dnajc13 UTSW 9 104172612 missense probably damaging 1.00
R1234:Dnajc13 UTSW 9 104214157 missense possibly damaging 0.64
R1433:Dnajc13 UTSW 9 104180121 missense probably damaging 1.00
R1463:Dnajc13 UTSW 9 104178940 missense probably damaging 1.00
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1464:Dnajc13 UTSW 9 104214167 missense probably benign 0.10
R1489:Dnajc13 UTSW 9 104231035 missense possibly damaging 0.94
R1575:Dnajc13 UTSW 9 104156838 missense probably benign 0.29
R1750:Dnajc13 UTSW 9 104221477 missense probably damaging 0.98
R1903:Dnajc13 UTSW 9 104228937 missense probably damaging 0.98
R2066:Dnajc13 UTSW 9 104221441 missense probably benign 0.01
R2206:Dnajc13 UTSW 9 104203518 missense probably damaging 1.00
R3160:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R3162:Dnajc13 UTSW 9 104219898 missense possibly damaging 0.57
R4158:Dnajc13 UTSW 9 104190442 missense probably damaging 0.96
R4460:Dnajc13 UTSW 9 104181063 missense probably damaging 0.96
R4537:Dnajc13 UTSW 9 104186805 intron probably benign
R4538:Dnajc13 UTSW 9 104186805 intron probably benign
R4631:Dnajc13 UTSW 9 104190417 missense probably damaging 1.00
R4662:Dnajc13 UTSW 9 104207758 missense probably damaging 1.00
R4722:Dnajc13 UTSW 9 104213818 missense probably benign
R4731:Dnajc13 UTSW 9 104186805 intron probably benign
R4732:Dnajc13 UTSW 9 104186805 intron probably benign
R4758:Dnajc13 UTSW 9 104172574 missense probably damaging 1.00
R4801:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4802:Dnajc13 UTSW 9 104175727 missense probably benign 0.16
R4928:Dnajc13 UTSW 9 104233638 missense possibly damaging 0.93
R4944:Dnajc13 UTSW 9 104167387 unclassified probably benign
R4979:Dnajc13 UTSW 9 104186723 missense probably damaging 1.00
R5177:Dnajc13 UTSW 9 104230986 missense probably benign 0.39
R5190:Dnajc13 UTSW 9 104174525 missense probably benign 0.00
R5256:Dnajc13 UTSW 9 104203329 missense possibly damaging 0.86
R5452:Dnajc13 UTSW 9 104192114 missense probably benign 0.01
R5657:Dnajc13 UTSW 9 104228537 missense probably damaging 1.00
R5752:Dnajc13 UTSW 9 104192774 splice site probably null
R5789:Dnajc13 UTSW 9 104214188 missense probably damaging 1.00
R5837:Dnajc13 UTSW 9 104176666 missense possibly damaging 0.88
R5846:Dnajc13 UTSW 9 104190385 missense probably damaging 0.99
R5982:Dnajc13 UTSW 9 104184615 missense possibly damaging 0.77
R6189:Dnajc13 UTSW 9 104213886 missense probably benign 0.12
R6355:Dnajc13 UTSW 9 104203270 missense probably damaging 0.99
R6483:Dnajc13 UTSW 9 104207804 missense probably damaging 0.96
R6613:Dnajc13 UTSW 9 104213877 missense probably benign 0.07
R6962:Dnajc13 UTSW 9 104181009 missense probably benign 0.02
R7048:Dnajc13 UTSW 9 104203414 critical splice donor site probably null
R7101:Dnajc13 UTSW 9 104165022 missense possibly damaging 0.92
R7304:Dnajc13 UTSW 9 104238514 missense probably benign 0.00
R7353:Dnajc13 UTSW 9 104230031 missense possibly damaging 0.89
R7366:Dnajc13 UTSW 9 104184706 missense probably benign 0.43
R7528:Dnajc13 UTSW 9 104178965 missense possibly damaging 0.65
R7635:Dnajc13 UTSW 9 104162367 missense probably benign
R7673:Dnajc13 UTSW 9 104233692 missense probably benign 0.09
R7856:Dnajc13 UTSW 9 104167485 missense possibly damaging 0.83
R7931:Dnajc13 UTSW 9 104218564 missense probably benign 0.02
R7995:Dnajc13 UTSW 9 104174363 missense probably damaging 1.00
R8319:Dnajc13 UTSW 9 104190391 missense probably benign 0.00
R8680:Dnajc13 UTSW 9 104180139 missense probably benign
R8686:Dnajc13 UTSW 9 104170805 missense probably benign 0.00
R8707:Dnajc13 UTSW 9 104192648 missense probably damaging 0.96
R8847:Dnajc13 UTSW 9 104180161 nonsense probably null
R8868:Dnajc13 UTSW 9 104165788 missense probably benign 0.13
R8986:Dnajc13 UTSW 9 104180131 missense probably damaging 1.00
R9139:Dnajc13 UTSW 9 104207840 missense probably benign 0.02
R9334:Dnajc13 UTSW 9 104174460 missense probably benign 0.00
R9353:Dnajc13 UTSW 9 104190372 missense probably benign 0.31
R9470:Dnajc13 UTSW 9 104230720 missense probably benign 0.01
R9528:Dnajc13 UTSW 9 104237705 missense probably benign
R9578:Dnajc13 UTSW 9 104238527 missense probably benign 0.04
X0017:Dnajc13 UTSW 9 104238478 missense possibly damaging 0.90
X0028:Dnajc13 UTSW 9 104165018 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGTGTACGTTCGTTCTCAG -3'
(R):5'- TCCGAGATGGATCTTTTCCTGATTC -3'

Sequencing Primer
(F):5'- ACGTTCGTTCTCAGGGTGAC -3'
(R):5'- CCTGATTCTGTTTTCCTAGTTAGTTG -3'
Posted On 2021-01-18