Incidental Mutation 'R8354:Rab36'
ID660613
Institutional Source Beutler Lab
Gene Symbol Rab36
Ensembl Gene ENSMUSG00000020175
Gene NameRAB36, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8354 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location75037058-75054748 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75048459 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 114 (A114T)
Ref Sequence ENSEMBL: ENSMUSP00000119399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020391] [ENSMUST00000139384] [ENSMUST00000146440] [ENSMUST00000147802]
Predicted Effect probably benign
Transcript: ENSMUST00000020391
SMART Domains Protein: ENSMUSP00000020391
Gene: ENSMUSG00000020175

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139384
AA Change: A80T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118718
Gene: ENSMUSG00000020175
AA Change: A80T

DomainStartEndE-ValueType
Pfam:Arf 42 134 6.3e-8 PFAM
Pfam:Ras 74 134 1.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146440
AA Change: A114T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121693
Gene: ENSMUSG00000020175
AA Change: A114T

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147802
AA Change: A114T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119399
Gene: ENSMUSG00000020175
AA Change: A114T

DomainStartEndE-ValueType
RAB 59 224 6.4e-45 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,834,377 S353R probably damaging Het
Ap1ar T C 3: 127,812,779 probably null Het
Asxl1 C A 2: 153,393,425 N213K probably benign Het
Cacna1e A G 1: 154,398,568 V2197A probably damaging Het
Cacna2d2 G A 9: 107,524,135 E706K possibly damaging Het
Cfap46 C T 7: 139,653,498 V296I probably benign Het
Cldn5 A G 16: 18,777,293 T100A probably benign Het
Ctnna1 C A 18: 35,252,723 N802K possibly damaging Het
Dip2c A G 13: 9,621,882 T968A probably benign Het
Dnaaf5 ACCCAGCACCTGGAGATCGTCC ACC 5: 139,161,859 probably null Het
Dnah8 A T 17: 30,643,260 D203V probably benign Het
Dnajc13 A G 9: 104,217,728 M585T probably damaging Het
Donson G T 16: 91,683,797 T262K possibly damaging Het
E2f3 T A 13: 29,985,804 probably benign Het
Fam110c A G 12: 31,075,179 E380G possibly damaging Het
Gbp9 T G 5: 105,094,161 T177P probably damaging Het
Gins3 C T 8: 95,638,018 A132V probably benign Het
Glra3 T A 8: 56,125,310 Y467* probably null Het
Gm12394 T A 4: 42,793,223 H303L probably benign Het
Gm7138 A G 10: 77,776,610 probably benign Het
Golim4 T C 3: 75,895,001 E328G probably damaging Het
Habp2 T A 19: 56,312,956 C270* probably null Het
Hecw2 A G 1: 53,925,308 probably null Het
Hmcn1 A T 1: 150,758,391 Y815N possibly damaging Het
Igfn1 A T 1: 135,959,881 C2482S possibly damaging Het
Igkv4-71 A G 6: 69,243,276 V57A probably damaging Het
Itpkb G A 1: 180,333,343 E345K possibly damaging Het
Itpr3 G A 17: 27,115,919 V2136M possibly damaging Het
Kcnh3 A G 15: 99,229,330 T336A probably damaging Het
Kdm4d T C 9: 14,463,939 T208A possibly damaging Het
Kntc1 T C 5: 123,778,267 F721S probably damaging Het
Krt10 A G 11: 99,389,260 probably benign Het
Lgals3bp T A 11: 118,398,541 N28I probably damaging Het
Matn2 T C 15: 34,378,697 L293P probably damaging Het
Mical3 T C 6: 120,973,420 E1010G probably damaging Het
Mpp4 C A 1: 59,130,065 R380L probably damaging Het
Msh5 A G 17: 35,031,766 F469L possibly damaging Het
Ncam2 A G 16: 81,512,959 T446A probably benign Het
Neurl4 A G 11: 69,909,236 D1050G probably damaging Het
Olfml2b T C 1: 170,682,224 Y714H possibly damaging Het
Olfr1173 T C 2: 88,274,692 D119G probably damaging Het
Olfr895 T C 9: 38,269,217 S235P probably benign Het
Pcnx2 T C 8: 125,761,618 E1729G probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pex1 T A 5: 3,631,707 L1051Q probably damaging Het
Prkag2 T A 5: 24,869,139 R283* probably null Het
Prrc1 T A 18: 57,371,431 M238K probably damaging Het
Ptprj T C 2: 90,469,717 T247A probably benign Het
Ptprz1 A G 6: 22,999,615 Y568C probably damaging Het
Rfx7 T C 9: 72,619,449 V1307A probably benign Het
Scaf1 A C 7: 45,007,827 probably benign Het
Sema4g A T 19: 44,998,427 T440S probably benign Het
Setbp1 A T 18: 78,857,383 V1023E probably damaging Het
Slc46a2 T C 4: 59,913,931 I331V possibly damaging Het
Slc4a7 C T 14: 14,786,313 R1000C probably damaging Het
Sorcs2 T C 5: 36,065,409 H162R probably benign Het
St5 G A 7: 109,525,548 R675* probably null Het
Strip2 G A 6: 29,920,532 probably null Het
Stx2 T A 5: 128,994,868 I42L probably benign Het
Tas2r124 A T 6: 132,755,447 T240S probably benign Het
Tgfbrap1 A T 1: 43,075,910 V10D probably damaging Het
Tmem41a T A 16: 21,947,431 Y19F probably benign Het
Tmprss5 A G 9: 49,107,139 T74A possibly damaging Het
Trim16 G T 11: 62,836,761 R216L probably benign Het
Trmt10c T C 16: 56,034,507 K255R probably benign Het
Trpm2 A T 10: 77,933,649 V747E probably damaging Het
Ube2v2 T C 16: 15,581,141 D28G possibly damaging Het
Uty G A Y: 1,157,928 T705I possibly damaging Het
Vmn2r80 A T 10: 79,148,876 I21F probably benign Het
Wdr11 T C 7: 129,602,999 L176S probably damaging Het
Zfp992 A G 4: 146,466,862 T347A probably benign Het
Other mutations in Rab36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01299:Rab36 APN 10 75048466 missense probably damaging 1.00
IGL01554:Rab36 APN 10 75050688 missense possibly damaging 0.50
IGL02197:Rab36 APN 10 75052042 missense probably damaging 0.96
R2022:Rab36 UTSW 10 75052474 missense probably benign 0.13
R2907:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R2991:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3012:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3033:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3034:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3035:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3036:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3440:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3686:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3687:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R3688:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4398:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4426:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4427:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4433:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4456:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4457:Rab36 UTSW 10 75044496 missense probably damaging 1.00
R4467:Rab36 UTSW 10 75052043 nonsense probably null
R4689:Rab36 UTSW 10 75041933 critical splice donor site probably null
R5043:Rab36 UTSW 10 75051005 missense probably benign 0.00
R5568:Rab36 UTSW 10 75052479 missense probably benign
R8523:Rab36 UTSW 10 75052503 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACTGTGATCTGAGGAAAGAATC -3'
(R):5'- GTGGCTTCTTCATTCCTAAGCG -3'

Sequencing Primer
(F):5'- TGTGATCTGAGGAAAGAATCTAGCAG -3'
(R):5'- TCATTCCTAAGCGCTGGC -3'
Posted On2021-01-18