Incidental Mutation 'R8354:Dip2c'
ID660622
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.689) question?
Stock #R8354 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9621882 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 968 (T968A)
Ref Sequence ENSEMBL: ENSMUSP00000131238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably benign
Transcript: ENSMUST00000166299
AA Change: T998A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: T998A

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169960
AA Change: T968A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: T968A

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174552
AA Change: T997A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: T997A

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,834,377 S353R probably damaging Het
Ap1ar T C 3: 127,812,779 probably null Het
Asxl1 C A 2: 153,393,425 N213K probably benign Het
Cacna1e A G 1: 154,398,568 V2197A probably damaging Het
Cacna2d2 G A 9: 107,524,135 E706K possibly damaging Het
Cfap46 C T 7: 139,653,498 V296I probably benign Het
Cldn5 A G 16: 18,777,293 T100A probably benign Het
Ctnna1 C A 18: 35,252,723 N802K possibly damaging Het
Dnaaf5 ACCCAGCACCTGGAGATCGTCC ACC 5: 139,161,859 probably null Het
Dnah8 A T 17: 30,643,260 D203V probably benign Het
Dnajc13 A G 9: 104,217,728 M585T probably damaging Het
Donson G T 16: 91,683,797 T262K possibly damaging Het
E2f3 T A 13: 29,985,804 probably benign Het
Fam110c A G 12: 31,075,179 E380G possibly damaging Het
Gbp9 T G 5: 105,094,161 T177P probably damaging Het
Gins3 C T 8: 95,638,018 A132V probably benign Het
Glra3 T A 8: 56,125,310 Y467* probably null Het
Gm12394 T A 4: 42,793,223 H303L probably benign Het
Gm7138 A G 10: 77,776,610 probably benign Het
Golim4 T C 3: 75,895,001 E328G probably damaging Het
Habp2 T A 19: 56,312,956 C270* probably null Het
Hecw2 A G 1: 53,925,308 probably null Het
Hmcn1 A T 1: 150,758,391 Y815N possibly damaging Het
Igfn1 A T 1: 135,959,881 C2482S possibly damaging Het
Igkv4-71 A G 6: 69,243,276 V57A probably damaging Het
Itpkb G A 1: 180,333,343 E345K possibly damaging Het
Itpr3 G A 17: 27,115,919 V2136M possibly damaging Het
Kcnh3 A G 15: 99,229,330 T336A probably damaging Het
Kdm4d T C 9: 14,463,939 T208A possibly damaging Het
Kntc1 T C 5: 123,778,267 F721S probably damaging Het
Krt10 A G 11: 99,389,260 probably benign Het
Lgals3bp T A 11: 118,398,541 N28I probably damaging Het
Matn2 T C 15: 34,378,697 L293P probably damaging Het
Mical3 T C 6: 120,973,420 E1010G probably damaging Het
Mpp4 C A 1: 59,130,065 R380L probably damaging Het
Msh5 A G 17: 35,031,766 F469L possibly damaging Het
Ncam2 A G 16: 81,512,959 T446A probably benign Het
Neurl4 A G 11: 69,909,236 D1050G probably damaging Het
Olfml2b T C 1: 170,682,224 Y714H possibly damaging Het
Olfr1173 T C 2: 88,274,692 D119G probably damaging Het
Olfr895 T C 9: 38,269,217 S235P probably benign Het
Pcnx2 T C 8: 125,761,618 E1729G probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pex1 T A 5: 3,631,707 L1051Q probably damaging Het
Prkag2 T A 5: 24,869,139 R283* probably null Het
Prrc1 T A 18: 57,371,431 M238K probably damaging Het
Ptprj T C 2: 90,469,717 T247A probably benign Het
Ptprz1 A G 6: 22,999,615 Y568C probably damaging Het
Rab36 G A 10: 75,048,459 A114T probably damaging Het
Rfx7 T C 9: 72,619,449 V1307A probably benign Het
Scaf1 A C 7: 45,007,827 probably benign Het
Sema4g A T 19: 44,998,427 T440S probably benign Het
Setbp1 A T 18: 78,857,383 V1023E probably damaging Het
Slc46a2 T C 4: 59,913,931 I331V possibly damaging Het
Slc4a7 C T 14: 14,786,313 R1000C probably damaging Het
Sorcs2 T C 5: 36,065,409 H162R probably benign Het
St5 G A 7: 109,525,548 R675* probably null Het
Strip2 G A 6: 29,920,532 probably null Het
Stx2 T A 5: 128,994,868 I42L probably benign Het
Tas2r124 A T 6: 132,755,447 T240S probably benign Het
Tgfbrap1 A T 1: 43,075,910 V10D probably damaging Het
Tmem41a T A 16: 21,947,431 Y19F probably benign Het
Tmprss5 A G 9: 49,107,139 T74A possibly damaging Het
Trim16 G T 11: 62,836,761 R216L probably benign Het
Trmt10c T C 16: 56,034,507 K255R probably benign Het
Trpm2 A T 10: 77,933,649 V747E probably damaging Het
Ube2v2 T C 16: 15,581,141 D28G possibly damaging Het
Uty G A Y: 1,157,928 T705I possibly damaging Het
Vmn2r80 A T 10: 79,148,876 I21F probably benign Het
Wdr11 T C 7: 129,602,999 L176S probably damaging Het
Zfp992 A G 4: 146,466,862 T347A probably benign Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7575:Dip2c UTSW 13 9628012 missense probably damaging 0.97
R7642:Dip2c UTSW 13 9622705 critical splice donor site probably null
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
R7842:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7845:Dip2c UTSW 13 9609044 missense probably damaging 1.00
R8685:Dip2c UTSW 13 9637125 missense probably benign 0.01
R8779:Dip2c UTSW 13 9610809 missense probably damaging 0.98
R8786:Dip2c UTSW 13 9615794 missense probably damaging 0.99
R8815:Dip2c UTSW 13 9623798 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCTTTACTGGTAAGCCTCTTTTG -3'
(R):5'- GGGCAACAAAGTGCTTCCTC -3'

Sequencing Primer
(F):5'- TTGAACTGCCTAGCTGAAGACCTAG -3'
(R):5'- GCAACAAAGTGCTTCCTCTCATTG -3'
Posted On2021-01-18