Incidental Mutation 'R8354:Dnah8'
ID 660633
Institutional Source Beutler Lab
Gene Symbol Dnah8
Ensembl Gene ENSMUSG00000033826
Gene Name dynein, axonemal, heavy chain 8
Synonyms Dnahc8, P1-Loop, Hst6.7b
MMRRC Submission 067806-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R8354 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 30624354-30875264 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30643260 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 203 (D203V)
Ref Sequence ENSEMBL: ENSMUSP00000127878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170651]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000170651
AA Change: D203V

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127878
Gene: ENSMUSG00000033826
AA Change: D203V

DomainStartEndE-ValueType
low complexity region 2 54 N/A INTRINSIC
Pfam:DHC_N1 379 936 8.4e-159 PFAM
low complexity region 1069 1080 N/A INTRINSIC
low complexity region 1224 1237 N/A INTRINSIC
Pfam:DHC_N2 1509 1917 1.6e-134 PFAM
AAA 2082 2226 1.38e-1 SMART
AAA 2363 2516 2.04e-1 SMART
AAA 2689 2837 8.15e-2 SMART
Pfam:AAA_8 3022 3294 4e-72 PFAM
Pfam:MT 3306 3656 3.6e-48 PFAM
Pfam:AAA_9 3676 3901 6.7e-85 PFAM
Pfam:Dynein_heavy 4039 4728 8.4e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a heavy chain of an axonemal dynein involved in sperm and respiratory cilia motility. Axonemal dyneins generate force through hydrolysis of ATP and binding to microtubules. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd12 A T 2: 150,834,377 (GRCm38) S353R probably damaging Het
Ap1ar T C 3: 127,812,779 (GRCm38) probably null Het
Asxl1 C A 2: 153,393,425 (GRCm38) N213K probably benign Het
Cacna1e A G 1: 154,398,568 (GRCm38) V2197A probably damaging Het
Cacna2d2 G A 9: 107,524,135 (GRCm38) E706K possibly damaging Het
Cfap46 C T 7: 139,653,498 (GRCm38) V296I probably benign Het
Cldn5 A G 16: 18,777,293 (GRCm38) T100A probably benign Het
Ctnna1 C A 18: 35,252,723 (GRCm38) N802K possibly damaging Het
Dip2c A G 13: 9,621,882 (GRCm38) T968A probably benign Het
Dnaaf5 ACCCAGCACCTGGAGATCGTCC ACC 5: 139,161,859 (GRCm38) probably null Het
Dnajc13 A G 9: 104,217,728 (GRCm38) M585T probably damaging Het
Donson G T 16: 91,683,797 (GRCm38) T262K possibly damaging Het
E2f3 T A 13: 29,985,804 (GRCm38) probably benign Het
Fam110c A G 12: 31,075,179 (GRCm38) E380G possibly damaging Het
Gbp9 T G 5: 105,094,161 (GRCm38) T177P probably damaging Het
Gins3 C T 8: 95,638,018 (GRCm38) A132V probably benign Het
Glra3 T A 8: 56,125,310 (GRCm38) Y467* probably null Het
Gm7138 A G 10: 77,776,610 (GRCm38) probably benign Het
Golim4 T C 3: 75,895,001 (GRCm38) E328G probably damaging Het
Habp2 T A 19: 56,312,956 (GRCm38) C270* probably null Het
Hecw2 A G 1: 53,925,308 (GRCm38) probably null Het
Hmcn1 A T 1: 150,758,391 (GRCm38) Y815N possibly damaging Het
Igfn1 A T 1: 135,959,881 (GRCm38) C2482S possibly damaging Het
Igkv4-71 A G 6: 69,243,276 (GRCm38) V57A probably damaging Het
Itpkb G A 1: 180,333,343 (GRCm38) E345K possibly damaging Het
Itpr3 G A 17: 27,115,919 (GRCm38) V2136M possibly damaging Het
Kcnh3 A G 15: 99,229,330 (GRCm38) T336A probably damaging Het
Kdm4d T C 9: 14,463,939 (GRCm38) T208A possibly damaging Het
Kntc1 T C 5: 123,778,267 (GRCm38) F721S probably damaging Het
Krt10 A G 11: 99,389,260 (GRCm38) probably benign Het
Lgals3bp T A 11: 118,398,541 (GRCm38) N28I probably damaging Het
Matn2 T C 15: 34,378,697 (GRCm38) L293P probably damaging Het
Mical3 T C 6: 120,973,420 (GRCm38) E1010G probably damaging Het
Mpp4 C A 1: 59,130,065 (GRCm38) R380L probably damaging Het
Msh5 A G 17: 35,031,766 (GRCm38) F469L possibly damaging Het
Ncam2 A G 16: 81,512,959 (GRCm38) T446A probably benign Het
Neurl4 A G 11: 69,909,236 (GRCm38) D1050G probably damaging Het
Olfml2b T C 1: 170,682,224 (GRCm38) Y714H possibly damaging Het
Or5d43 T C 2: 88,274,692 (GRCm38) D119G probably damaging Het
Or8c17 T C 9: 38,269,217 (GRCm38) S235P probably benign Het
Pcnx2 T C 8: 125,761,618 (GRCm38) E1729G probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 (GRCm38) probably benign Het
Pex1 T A 5: 3,631,707 (GRCm38) L1051Q probably damaging Het
Prkag2 T A 5: 24,869,139 (GRCm38) R283* probably null Het
Prrc1 T A 18: 57,371,431 (GRCm38) M238K probably damaging Het
Ptprj T C 2: 90,469,717 (GRCm38) T247A probably benign Het
Ptprz1 A G 6: 22,999,615 (GRCm38) Y568C probably damaging Het
Rab36 G A 10: 75,048,459 (GRCm38) A114T probably damaging Het
Rfx7 T C 9: 72,619,449 (GRCm38) V1307A probably benign Het
Scaf1 A C 7: 45,007,827 (GRCm38) probably benign Het
Sema4g A T 19: 44,998,427 (GRCm38) T440S probably benign Het
Setbp1 A T 18: 78,857,383 (GRCm38) V1023E probably damaging Het
Slc46a2 T C 4: 59,913,931 (GRCm38) I331V possibly damaging Het
Slc4a7 C T 14: 14,786,313 (GRCm38) R1000C probably damaging Het
Sorcs2 T C 5: 36,065,409 (GRCm38) H162R probably benign Het
Spata31f1e T A 4: 42,793,223 (GRCm38) H303L probably benign Het
St5 G A 7: 109,525,548 (GRCm38) R675* probably null Het
Strip2 G A 6: 29,920,532 (GRCm38) probably null Het
Stx2 T A 5: 128,994,868 (GRCm38) I42L probably benign Het
Tas2r124 A T 6: 132,755,447 (GRCm38) T240S probably benign Het
Tgfbrap1 A T 1: 43,075,910 (GRCm38) V10D probably damaging Het
Tmem41a T A 16: 21,947,431 (GRCm38) Y19F probably benign Het
Tmprss5 A G 9: 49,107,139 (GRCm38) T74A possibly damaging Het
Trim16 G T 11: 62,836,761 (GRCm38) R216L probably benign Het
Trmt10c T C 16: 56,034,507 (GRCm38) K255R probably benign Het
Trpm2 A T 10: 77,933,649 (GRCm38) V747E probably damaging Het
Ube2v2 T C 16: 15,581,141 (GRCm38) D28G possibly damaging Het
Uty G A Y: 1,157,928 (GRCm38) T705I possibly damaging Het
Vmn2r80 A T 10: 79,148,876 (GRCm38) I21F probably benign Het
Wdr11 T C 7: 129,602,999 (GRCm38) L176S probably damaging Het
Zfp992 A G 4: 146,466,862 (GRCm38) T347A probably benign Het
Other mutations in Dnah8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dnah8 APN 17 30,677,176 (GRCm38) missense probably benign 0.06
IGL00508:Dnah8 APN 17 30,855,930 (GRCm38) missense probably damaging 1.00
IGL00547:Dnah8 APN 17 30,815,703 (GRCm38) nonsense probably null
IGL00551:Dnah8 APN 17 30,663,478 (GRCm38) nonsense probably null
IGL00732:Dnah8 APN 17 30,656,641 (GRCm38) missense probably damaging 1.00
IGL00775:Dnah8 APN 17 30,767,906 (GRCm38) nonsense probably null
IGL00840:Dnah8 APN 17 30,790,941 (GRCm38) missense probably damaging 1.00
IGL00845:Dnah8 APN 17 30,819,276 (GRCm38) critical splice donor site probably null
IGL00953:Dnah8 APN 17 30,706,457 (GRCm38) nonsense probably null
IGL00976:Dnah8 APN 17 30,851,710 (GRCm38) missense probably damaging 0.98
IGL01395:Dnah8 APN 17 30,636,005 (GRCm38) missense probably benign 0.06
IGL01467:Dnah8 APN 17 30,779,916 (GRCm38) missense probably damaging 1.00
IGL01469:Dnah8 APN 17 30,683,714 (GRCm38) splice site probably benign
IGL01515:Dnah8 APN 17 30,648,485 (GRCm38) missense probably benign
IGL01723:Dnah8 APN 17 30,708,471 (GRCm38) missense probably damaging 1.00
IGL01837:Dnah8 APN 17 30,751,591 (GRCm38) critical splice donor site probably null
IGL01921:Dnah8 APN 17 30,736,141 (GRCm38) missense probably benign
IGL01958:Dnah8 APN 17 30,855,895 (GRCm38) splice site probably benign
IGL01968:Dnah8 APN 17 30,656,598 (GRCm38) nonsense probably null
IGL02093:Dnah8 APN 17 30,717,880 (GRCm38) missense probably damaging 0.99
IGL02151:Dnah8 APN 17 30,648,417 (GRCm38) missense possibly damaging 0.50
IGL02182:Dnah8 APN 17 30,794,763 (GRCm38) missense possibly damaging 0.45
IGL02233:Dnah8 APN 17 30,706,513 (GRCm38) critical splice donor site probably null
IGL02236:Dnah8 APN 17 30,649,773 (GRCm38) nonsense probably null
IGL02259:Dnah8 APN 17 30,759,614 (GRCm38) missense probably benign
IGL02263:Dnah8 APN 17 30,729,165 (GRCm38) missense probably benign 0.00
IGL02303:Dnah8 APN 17 30,713,047 (GRCm38) missense probably benign 0.03
IGL02341:Dnah8 APN 17 30,747,257 (GRCm38) missense probably damaging 1.00
IGL02351:Dnah8 APN 17 30,767,811 (GRCm38) missense probably damaging 1.00
IGL02358:Dnah8 APN 17 30,767,811 (GRCm38) missense probably damaging 1.00
IGL02377:Dnah8 APN 17 30,794,796 (GRCm38) missense probably damaging 0.98
IGL02390:Dnah8 APN 17 30,830,845 (GRCm38) missense probably benign 0.01
IGL02392:Dnah8 APN 17 30,818,051 (GRCm38) splice site probably benign
IGL02414:Dnah8 APN 17 30,700,413 (GRCm38) missense probably benign
IGL02455:Dnah8 APN 17 30,672,334 (GRCm38) missense probably damaging 0.99
IGL02817:Dnah8 APN 17 30,668,295 (GRCm38) missense probably benign
IGL02831:Dnah8 APN 17 30,712,276 (GRCm38) missense probably benign 0.23
IGL02863:Dnah8 APN 17 30,769,697 (GRCm38) missense probably damaging 1.00
IGL02894:Dnah8 APN 17 30,721,110 (GRCm38) nonsense probably null
IGL02954:Dnah8 APN 17 30,704,835 (GRCm38) missense probably benign 0.30
IGL02964:Dnah8 APN 17 30,746,761 (GRCm38) missense probably damaging 1.00
IGL03080:Dnah8 APN 17 30,719,006 (GRCm38) missense probably benign 0.01
IGL03081:Dnah8 APN 17 30,686,373 (GRCm38) splice site probably benign
IGL03086:Dnah8 APN 17 30,742,780 (GRCm38) missense probably damaging 1.00
IGL03087:Dnah8 APN 17 30,784,144 (GRCm38) missense probably benign
IGL03176:Dnah8 APN 17 30,694,037 (GRCm38) missense probably benign
IGL03191:Dnah8 APN 17 30,726,830 (GRCm38) missense probably damaging 0.99
IGL03210:Dnah8 APN 17 30,815,665 (GRCm38) missense probably damaging 0.96
IGL03252:Dnah8 APN 17 30,673,920 (GRCm38) splice site probably null
IGL03255:Dnah8 APN 17 30,741,381 (GRCm38) missense probably damaging 1.00
IGL03288:Dnah8 APN 17 30,672,349 (GRCm38) missense probably benign
IGL03348:Dnah8 APN 17 30,746,986 (GRCm38) missense probably damaging 0.99
Alternator UTSW 17 30,765,635 (GRCm38) missense probably benign
armature UTSW 17 30,708,390 (GRCm38) missense probably benign 0.02
Brush UTSW 17 30,746,990 (GRCm38) missense probably damaging 1.00
Dynos UTSW 17 30,715,509 (GRCm38) missense possibly damaging 0.84
joule UTSW 17 30,713,098 (GRCm38) critical splice donor site probably null
solenoid UTSW 17 30,741,178 (GRCm38) missense probably damaging 1.00
FR4340:Dnah8 UTSW 17 30,635,463 (GRCm38) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,635,477 (GRCm38) small deletion probably benign
FR4737:Dnah8 UTSW 17 30,635,465 (GRCm38) small deletion probably benign
I2288:Dnah8 UTSW 17 30,663,454 (GRCm38) missense probably benign
P0029:Dnah8 UTSW 17 30,765,720 (GRCm38) missense probably damaging 1.00
PIT4812001:Dnah8 UTSW 17 30,708,445 (GRCm38) missense probably benign 0.04
R0016:Dnah8 UTSW 17 30,663,316 (GRCm38) missense probably benign
R0035:Dnah8 UTSW 17 30,683,621 (GRCm38) splice site probably benign
R0035:Dnah8 UTSW 17 30,683,621 (GRCm38) splice site probably benign
R0062:Dnah8 UTSW 17 30,765,711 (GRCm38) missense probably damaging 1.00
R0062:Dnah8 UTSW 17 30,765,711 (GRCm38) missense probably damaging 1.00
R0087:Dnah8 UTSW 17 30,755,119 (GRCm38) missense probably damaging 1.00
R0090:Dnah8 UTSW 17 30,784,090 (GRCm38) missense probably benign 0.20
R0119:Dnah8 UTSW 17 30,715,509 (GRCm38) missense possibly damaging 0.84
R0164:Dnah8 UTSW 17 30,748,665 (GRCm38) missense probably benign
R0164:Dnah8 UTSW 17 30,748,665 (GRCm38) missense probably benign
R0184:Dnah8 UTSW 17 30,683,683 (GRCm38) missense probably benign 0.04
R0240:Dnah8 UTSW 17 30,765,679 (GRCm38) missense probably damaging 0.98
R0240:Dnah8 UTSW 17 30,765,679 (GRCm38) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,765,679 (GRCm38) missense probably damaging 0.98
R0241:Dnah8 UTSW 17 30,765,679 (GRCm38) missense probably damaging 0.98
R0265:Dnah8 UTSW 17 30,690,271 (GRCm38) missense probably benign
R0268:Dnah8 UTSW 17 30,769,707 (GRCm38) missense probably damaging 1.00
R0282:Dnah8 UTSW 17 30,736,156 (GRCm38) missense probably damaging 1.00
R0299:Dnah8 UTSW 17 30,715,509 (GRCm38) missense possibly damaging 0.84
R0334:Dnah8 UTSW 17 30,871,351 (GRCm38) missense probably damaging 0.99
R0393:Dnah8 UTSW 17 30,708,390 (GRCm38) missense probably benign 0.02
R0423:Dnah8 UTSW 17 30,701,981 (GRCm38) missense probably benign
R0470:Dnah8 UTSW 17 30,708,540 (GRCm38) splice site probably benign
R0477:Dnah8 UTSW 17 30,755,080 (GRCm38) missense probably damaging 1.00
R0490:Dnah8 UTSW 17 30,700,419 (GRCm38) missense probably benign
R0499:Dnah8 UTSW 17 30,715,509 (GRCm38) missense possibly damaging 0.84
R0582:Dnah8 UTSW 17 30,718,961 (GRCm38) missense probably benign 0.01
R0601:Dnah8 UTSW 17 30,708,358 (GRCm38) missense probably benign 0.06
R0646:Dnah8 UTSW 17 30,684,173 (GRCm38) missense probably damaging 0.97
R0665:Dnah8 UTSW 17 30,736,155 (GRCm38) missense probably damaging 0.99
R0800:Dnah8 UTSW 17 30,704,662 (GRCm38) missense probably benign
R0843:Dnah8 UTSW 17 30,813,095 (GRCm38) missense probably damaging 1.00
R0940:Dnah8 UTSW 17 30,803,243 (GRCm38) missense probably damaging 1.00
R0964:Dnah8 UTSW 17 30,673,920 (GRCm38) splice site probably null
R1102:Dnah8 UTSW 17 30,854,764 (GRCm38) splice site probably null
R1137:Dnah8 UTSW 17 30,855,936 (GRCm38) missense probably damaging 1.00
R1342:Dnah8 UTSW 17 30,721,000 (GRCm38) missense probably damaging 0.99
R1375:Dnah8 UTSW 17 30,737,295 (GRCm38) missense probably damaging 1.00
R1377:Dnah8 UTSW 17 30,840,622 (GRCm38) nonsense probably null
R1464:Dnah8 UTSW 17 30,695,173 (GRCm38) missense possibly damaging 0.81
R1464:Dnah8 UTSW 17 30,695,173 (GRCm38) missense possibly damaging 0.81
R1470:Dnah8 UTSW 17 30,747,277 (GRCm38) nonsense probably null
R1470:Dnah8 UTSW 17 30,747,277 (GRCm38) nonsense probably null
R1497:Dnah8 UTSW 17 30,752,075 (GRCm38) missense probably damaging 1.00
R1513:Dnah8 UTSW 17 30,673,888 (GRCm38) missense probably benign
R1541:Dnah8 UTSW 17 30,747,247 (GRCm38) missense probably damaging 1.00
R1563:Dnah8 UTSW 17 30,635,664 (GRCm38) missense probably benign 0.07
R1634:Dnah8 UTSW 17 30,713,098 (GRCm38) critical splice donor site probably null
R1670:Dnah8 UTSW 17 30,725,124 (GRCm38) missense probably damaging 1.00
R1710:Dnah8 UTSW 17 30,854,940 (GRCm38) missense probably damaging 1.00
R1743:Dnah8 UTSW 17 30,769,651 (GRCm38) missense probably benign 0.28
R1761:Dnah8 UTSW 17 30,779,916 (GRCm38) missense probably damaging 1.00
R1785:Dnah8 UTSW 17 30,722,937 (GRCm38) missense probably damaging 0.98
R1804:Dnah8 UTSW 17 30,708,407 (GRCm38) missense probably benign 0.00
R1808:Dnah8 UTSW 17 30,684,186 (GRCm38) missense probably damaging 1.00
R1824:Dnah8 UTSW 17 30,731,180 (GRCm38) missense possibly damaging 0.67
R1836:Dnah8 UTSW 17 30,874,927 (GRCm38) missense possibly damaging 0.94
R1935:Dnah8 UTSW 17 30,635,505 (GRCm38) missense unknown
R1935:Dnah8 UTSW 17 30,726,896 (GRCm38) splice site probably benign
R1940:Dnah8 UTSW 17 30,731,207 (GRCm38) missense probably damaging 1.00
R1946:Dnah8 UTSW 17 30,712,385 (GRCm38) missense probably benign 0.00
R2025:Dnah8 UTSW 17 30,731,159 (GRCm38) missense probably damaging 0.99
R2038:Dnah8 UTSW 17 30,758,281 (GRCm38) missense probably damaging 1.00
R2042:Dnah8 UTSW 17 30,635,658 (GRCm38) missense probably benign 0.01
R2148:Dnah8 UTSW 17 30,737,258 (GRCm38) missense probably damaging 1.00
R2177:Dnah8 UTSW 17 30,653,393 (GRCm38) missense probably benign
R2180:Dnah8 UTSW 17 30,840,647 (GRCm38) missense probably benign 0.00
R2262:Dnah8 UTSW 17 30,673,835 (GRCm38) missense probably damaging 1.00
R2263:Dnah8 UTSW 17 30,673,835 (GRCm38) missense probably damaging 1.00
R2328:Dnah8 UTSW 17 30,794,744 (GRCm38) missense probably damaging 1.00
R2357:Dnah8 UTSW 17 30,771,872 (GRCm38) missense probably benign
R2357:Dnah8 UTSW 17 30,874,935 (GRCm38) missense probably benign 0.00
R2360:Dnah8 UTSW 17 30,677,204 (GRCm38) missense probably benign 0.22
R2496:Dnah8 UTSW 17 30,851,731 (GRCm38) missense probably damaging 1.00
R2497:Dnah8 UTSW 17 30,741,365 (GRCm38) nonsense probably null
R2509:Dnah8 UTSW 17 30,775,045 (GRCm38) missense probably benign 0.02
R3114:Dnah8 UTSW 17 30,833,568 (GRCm38) missense probably benign 0.04
R3708:Dnah8 UTSW 17 30,739,657 (GRCm38) missense probably damaging 0.98
R3720:Dnah8 UTSW 17 30,854,898 (GRCm38) missense probably damaging 1.00
R3722:Dnah8 UTSW 17 30,854,898 (GRCm38) missense probably damaging 1.00
R3727:Dnah8 UTSW 17 30,739,648 (GRCm38) nonsense probably null
R3747:Dnah8 UTSW 17 30,784,174 (GRCm38) nonsense probably null
R3748:Dnah8 UTSW 17 30,784,174 (GRCm38) nonsense probably null
R3749:Dnah8 UTSW 17 30,784,174 (GRCm38) nonsense probably null
R3787:Dnah8 UTSW 17 30,755,041 (GRCm38) missense probably damaging 1.00
R3790:Dnah8 UTSW 17 30,854,898 (GRCm38) missense probably damaging 1.00
R3804:Dnah8 UTSW 17 30,670,647 (GRCm38) missense probably benign 0.00
R3857:Dnah8 UTSW 17 30,663,422 (GRCm38) missense probably damaging 0.96
R3898:Dnah8 UTSW 17 30,854,898 (GRCm38) missense probably damaging 1.00
R3899:Dnah8 UTSW 17 30,854,898 (GRCm38) missense probably damaging 1.00
R3938:Dnah8 UTSW 17 30,854,937 (GRCm38) missense probably damaging 1.00
R3943:Dnah8 UTSW 17 30,694,065 (GRCm38) splice site probably benign
R4091:Dnah8 UTSW 17 30,769,839 (GRCm38) missense probably damaging 1.00
R4291:Dnah8 UTSW 17 30,748,559 (GRCm38) missense probably benign
R4326:Dnah8 UTSW 17 30,752,092 (GRCm38) missense probably benign 0.04
R4346:Dnah8 UTSW 17 30,725,098 (GRCm38) missense possibly damaging 0.92
R4429:Dnah8 UTSW 17 30,752,146 (GRCm38) missense probably damaging 1.00
R4457:Dnah8 UTSW 17 30,813,151 (GRCm38) missense probably benign
R4475:Dnah8 UTSW 17 30,656,985 (GRCm38) missense probably benign 0.12
R4565:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4566:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4568:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4573:Dnah8 UTSW 17 30,700,406 (GRCm38) missense probably benign 0.00
R4580:Dnah8 UTSW 17 30,662,052 (GRCm38) missense probably benign 0.00
R4585:Dnah8 UTSW 17 30,751,567 (GRCm38) missense probably benign 0.01
R4611:Dnah8 UTSW 17 30,684,237 (GRCm38) missense probably damaging 1.00
R4720:Dnah8 UTSW 17 30,683,634 (GRCm38) missense probably benign 0.08
R4721:Dnah8 UTSW 17 30,725,166 (GRCm38) missense probably damaging 1.00
R4727:Dnah8 UTSW 17 30,851,747 (GRCm38) missense probably damaging 1.00
R4731:Dnah8 UTSW 17 30,775,061 (GRCm38) missense probably null 0.02
R4732:Dnah8 UTSW 17 30,775,061 (GRCm38) missense probably null 0.02
R4733:Dnah8 UTSW 17 30,775,061 (GRCm38) missense probably null 0.02
R4798:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4814:Dnah8 UTSW 17 30,767,924 (GRCm38) missense probably damaging 1.00
R4892:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4894:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4900:Dnah8 UTSW 17 30,746,975 (GRCm38) missense probably damaging 1.00
R4901:Dnah8 UTSW 17 30,840,714 (GRCm38) critical splice donor site probably null
R4913:Dnah8 UTSW 17 30,819,139 (GRCm38) missense probably damaging 0.99
R4931:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4932:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4933:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R4942:Dnah8 UTSW 17 30,729,142 (GRCm38) missense probably benign
R4969:Dnah8 UTSW 17 30,723,014 (GRCm38) missense probably damaging 1.00
R4975:Dnah8 UTSW 17 30,656,985 (GRCm38) missense probably benign 0.12
R4977:Dnah8 UTSW 17 30,663,301 (GRCm38) missense probably benign 0.00
R5001:Dnah8 UTSW 17 30,787,185 (GRCm38) missense probably damaging 1.00
R5011:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5013:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5014:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5024:Dnah8 UTSW 17 30,736,096 (GRCm38) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5075:Dnah8 UTSW 17 30,800,531 (GRCm38) missense probably damaging 1.00
R5075:Dnah8 UTSW 17 30,739,757 (GRCm38) critical splice donor site probably null
R5112:Dnah8 UTSW 17 30,731,038 (GRCm38) missense probably benign 0.02
R5121:Dnah8 UTSW 17 30,810,353 (GRCm38) missense probably benign 0.14
R5138:Dnah8 UTSW 17 30,765,597 (GRCm38) missense probably damaging 0.99
R5151:Dnah8 UTSW 17 30,712,295 (GRCm38) missense probably benign 0.06
R5191:Dnah8 UTSW 17 30,746,765 (GRCm38) missense probably damaging 1.00
R5238:Dnah8 UTSW 17 30,790,917 (GRCm38) missense probably damaging 1.00
R5260:Dnah8 UTSW 17 30,700,419 (GRCm38) missense probably benign
R5358:Dnah8 UTSW 17 30,746,954 (GRCm38) missense probably damaging 1.00
R5403:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5404:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5482:Dnah8 UTSW 17 30,800,547 (GRCm38) missense probably damaging 0.96
R5489:Dnah8 UTSW 17 30,790,956 (GRCm38) missense probably damaging 1.00
R5513:Dnah8 UTSW 17 30,752,916 (GRCm38) missense probably damaging 0.99
R5635:Dnah8 UTSW 17 30,706,386 (GRCm38) missense probably benign 0.00
R5640:Dnah8 UTSW 17 30,803,108 (GRCm38) missense probably damaging 1.00
R5649:Dnah8 UTSW 17 30,800,587 (GRCm38) missense probably benign 0.13
R5662:Dnah8 UTSW 17 30,737,333 (GRCm38) missense probably damaging 1.00
R5673:Dnah8 UTSW 17 30,803,261 (GRCm38) missense probably damaging 1.00
R5677:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5699:Dnah8 UTSW 17 30,810,324 (GRCm38) missense probably benign 0.22
R5737:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5738:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R5739:Dnah8 UTSW 17 30,719,007 (GRCm38) missense probably benign 0.00
R5766:Dnah8 UTSW 17 30,690,261 (GRCm38) missense probably benign 0.01
R5790:Dnah8 UTSW 17 30,875,004 (GRCm38) missense probably damaging 0.98
R5848:Dnah8 UTSW 17 30,728,191 (GRCm38) missense possibly damaging 0.69
R5854:Dnah8 UTSW 17 30,794,763 (GRCm38) missense possibly damaging 0.45
R5885:Dnah8 UTSW 17 30,794,717 (GRCm38) missense probably damaging 1.00
R5886:Dnah8 UTSW 17 30,794,717 (GRCm38) missense probably damaging 1.00
R5887:Dnah8 UTSW 17 30,794,717 (GRCm38) missense probably damaging 1.00
R5899:Dnah8 UTSW 17 30,656,685 (GRCm38) missense probably benign 0.32
R5979:Dnah8 UTSW 17 30,815,664 (GRCm38) nonsense probably null
R5986:Dnah8 UTSW 17 30,851,630 (GRCm38) missense possibly damaging 0.83
R5999:Dnah8 UTSW 17 30,663,305 (GRCm38) missense probably benign 0.32
R6042:Dnah8 UTSW 17 30,747,265 (GRCm38) missense probably damaging 1.00
R6175:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6181:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6237:Dnah8 UTSW 17 30,747,854 (GRCm38) nonsense probably null
R6239:Dnah8 UTSW 17 30,810,359 (GRCm38) missense probably damaging 0.99
R6337:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6365:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6416:Dnah8 UTSW 17 30,765,635 (GRCm38) missense probably benign
R6443:Dnah8 UTSW 17 30,771,885 (GRCm38) missense probably benign 0.10
R6478:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6479:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6480:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6481:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6533:Dnah8 UTSW 17 30,746,990 (GRCm38) missense probably damaging 1.00
R6606:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6608:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6610:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6675:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6723:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6724:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6754:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6755:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6759:Dnah8 UTSW 17 30,663,292 (GRCm38) splice site probably null
R6765:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6766:Dnah8 UTSW 17 30,748,568 (GRCm38) missense probably benign 0.00
R6778:Dnah8 UTSW 17 30,635,666 (GRCm38) missense probably benign 0.00
R6781:Dnah8 UTSW 17 30,765,724 (GRCm38) frame shift probably null
R6788:Dnah8 UTSW 17 30,648,465 (GRCm38) missense probably benign 0.14
R6814:Dnah8 UTSW 17 30,762,679 (GRCm38) missense probably damaging 1.00
R6825:Dnah8 UTSW 17 30,741,173 (GRCm38) missense probably damaging 1.00
R6838:Dnah8 UTSW 17 30,710,551 (GRCm38) missense probably damaging 1.00
R6872:Dnah8 UTSW 17 30,762,679 (GRCm38) missense probably damaging 1.00
R6877:Dnah8 UTSW 17 30,746,959 (GRCm38) missense probably damaging 1.00
R6944:Dnah8 UTSW 17 30,794,659 (GRCm38) missense probably benign 0.09
R6982:Dnah8 UTSW 17 30,767,925 (GRCm38) missense probably benign 0.03
R6984:Dnah8 UTSW 17 30,739,738 (GRCm38) missense probably damaging 1.00
R6987:Dnah8 UTSW 17 30,662,091 (GRCm38) missense possibly damaging 0.95
R6988:Dnah8 UTSW 17 30,643,275 (GRCm38) missense probably damaging 1.00
R7099:Dnah8 UTSW 17 30,704,724 (GRCm38) missense possibly damaging 0.93
R7106:Dnah8 UTSW 17 30,741,178 (GRCm38) missense probably damaging 1.00
R7112:Dnah8 UTSW 17 30,871,392 (GRCm38) missense possibly damaging 0.79
R7146:Dnah8 UTSW 17 30,769,644 (GRCm38) missense possibly damaging 0.90
R7146:Dnah8 UTSW 17 30,644,617 (GRCm38) missense probably benign 0.01
R7309:Dnah8 UTSW 17 30,875,014 (GRCm38) missense probably damaging 1.00
R7324:Dnah8 UTSW 17 30,784,125 (GRCm38) missense probably benign 0.01
R7373:Dnah8 UTSW 17 30,767,965 (GRCm38) critical splice donor site probably null
R7423:Dnah8 UTSW 17 30,704,769 (GRCm38) missense possibly damaging 0.86
R7430:Dnah8 UTSW 17 30,706,389 (GRCm38) missense probably damaging 0.98
R7450:Dnah8 UTSW 17 30,787,191 (GRCm38) missense probably damaging 0.99
R7580:Dnah8 UTSW 17 30,775,103 (GRCm38) missense probably damaging 0.98
R7604:Dnah8 UTSW 17 30,813,095 (GRCm38) missense probably damaging 1.00
R7635:Dnah8 UTSW 17 30,785,107 (GRCm38) missense probably damaging 1.00
R7646:Dnah8 UTSW 17 30,649,677 (GRCm38) missense probably benign 0.00
R7685:Dnah8 UTSW 17 30,657,973 (GRCm38) missense probably damaging 1.00
R7793:Dnah8 UTSW 17 30,855,944 (GRCm38) missense probably benign 0.20
R7827:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R7866:Dnah8 UTSW 17 30,874,927 (GRCm38) missense possibly damaging 0.94
R7877:Dnah8 UTSW 17 30,663,374 (GRCm38) missense probably benign
R7891:Dnah8 UTSW 17 30,712,289 (GRCm38) missense probably benign 0.09
R7977:Dnah8 UTSW 17 30,744,524 (GRCm38) missense probably damaging 1.00
R7987:Dnah8 UTSW 17 30,744,524 (GRCm38) missense probably damaging 1.00
R8025:Dnah8 UTSW 17 30,741,337 (GRCm38) nonsense probably null
R8076:Dnah8 UTSW 17 30,784,153 (GRCm38) missense possibly damaging 0.94
R8170:Dnah8 UTSW 17 30,673,823 (GRCm38) missense probably damaging 1.00
R8199:Dnah8 UTSW 17 30,871,419 (GRCm38) missense probably benign 0.06
R8253:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R8270:Dnah8 UTSW 17 30,840,713 (GRCm38) missense probably damaging 1.00
R8291:Dnah8 UTSW 17 30,765,727 (GRCm38) missense probably damaging 1.00
R8334:Dnah8 UTSW 17 30,769,831 (GRCm38) missense probably benign 0.12
R8348:Dnah8 UTSW 17 30,673,840 (GRCm38) missense probably benign
R8348:Dnah8 UTSW 17 30,736,147 (GRCm38) missense probably damaging 0.96
R8355:Dnah8 UTSW 17 30,695,178 (GRCm38) missense possibly damaging 0.89
R8439:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R8448:Dnah8 UTSW 17 30,673,840 (GRCm38) missense probably benign
R8459:Dnah8 UTSW 17 30,725,247 (GRCm38) critical splice donor site probably null
R8462:Dnah8 UTSW 17 30,656,629 (GRCm38) missense probably damaging 1.00
R8506:Dnah8 UTSW 17 30,721,134 (GRCm38) missense probably benign
R8524:Dnah8 UTSW 17 30,715,498 (GRCm38) missense possibly damaging 0.95
R8555:Dnah8 UTSW 17 30,721,110 (GRCm38) nonsense probably null
R8698:Dnah8 UTSW 17 30,875,035 (GRCm38) missense probably damaging 1.00
R8719:Dnah8 UTSW 17 30,741,315 (GRCm38) missense probably damaging 0.97
R8778:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R8781:Dnah8 UTSW 17 30,725,104 (GRCm38) missense probably damaging 1.00
R8821:Dnah8 UTSW 17 30,794,738 (GRCm38) missense probably damaging 1.00
R8864:Dnah8 UTSW 17 30,762,642 (GRCm38) missense possibly damaging 0.95
R8885:Dnah8 UTSW 17 30,708,312 (GRCm38) missense possibly damaging 0.83
R8983:Dnah8 UTSW 17 30,851,654 (GRCm38) missense probably damaging 0.98
R8994:Dnah8 UTSW 17 30,790,833 (GRCm38) missense probably benign 0.05
R9031:Dnah8 UTSW 17 30,737,427 (GRCm38) missense probably damaging 1.00
R9068:Dnah8 UTSW 17 30,756,755 (GRCm38) missense possibly damaging 0.63
R9225:Dnah8 UTSW 17 30,635,673 (GRCm38) missense probably benign 0.01
R9280:Dnah8 UTSW 17 30,785,097 (GRCm38) missense possibly damaging 0.52
R9291:Dnah8 UTSW 17 30,725,125 (GRCm38) missense probably damaging 1.00
R9314:Dnah8 UTSW 17 30,771,883 (GRCm38) missense probably benign
R9347:Dnah8 UTSW 17 30,708,359 (GRCm38) missense probably benign 0.00
R9393:Dnah8 UTSW 17 30,653,387 (GRCm38) missense possibly damaging 0.53
R9415:Dnah8 UTSW 17 30,810,323 (GRCm38) missense probably benign 0.02
R9458:Dnah8 UTSW 17 30,830,803 (GRCm38) missense probably damaging 1.00
R9465:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R9518:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R9524:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R9564:Dnah8 UTSW 17 30,713,047 (GRCm38) missense probably benign 0.07
R9587:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R9599:Dnah8 UTSW 17 30,760,867 (GRCm38) frame shift probably null
R9641:Dnah8 UTSW 17 30,713,055 (GRCm38) missense probably benign 0.13
R9674:Dnah8 UTSW 17 30,779,138 (GRCm38) missense possibly damaging 0.84
R9679:Dnah8 UTSW 17 30,818,141 (GRCm38) missense probably benign
R9789:Dnah8 UTSW 17 30,761,130 (GRCm38) critical splice donor site probably null
RF027:Dnah8 UTSW 17 30,635,476 (GRCm38) frame shift probably null
X0001:Dnah8 UTSW 17 30,748,680 (GRCm38) missense probably damaging 1.00
X0013:Dnah8 UTSW 17 30,819,186 (GRCm38) missense possibly damaging 0.71
Z1176:Dnah8 UTSW 17 30,648,540 (GRCm38) missense probably benign
Z1177:Dnah8 UTSW 17 30,713,095 (GRCm38) missense probably null 1.00
Z1177:Dnah8 UTSW 17 30,694,033 (GRCm38) missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTTAAATTTCCCGTCCATTAGG -3'
(R):5'- CAGATTTCTGGTCAAGTTTTCCTG -3'

Sequencing Primer
(F):5'- CAAAATTGCCTAGGCTGGTC -3'
(R):5'- CAAGTTTTCCTGTGAAAGTGGAAAG -3'
Posted On 2021-01-18