Incidental Mutation 'R8437:Gfpt2'
ID 660651
Institutional Source Beutler Lab
Gene Symbol Gfpt2
Ensembl Gene ENSMUSG00000020363
Gene Name glutamine fructose-6-phosphate transaminase 2
Synonyms GFAT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8437 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 49794178-49838613 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) T to A at 49804867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020629]
AlphaFold Q9Z2Z9
Predicted Effect probably benign
Transcript: ENSMUST00000020629
SMART Domains Protein: ENSMUSP00000020629
Gene: ENSMUSG00000020363

DomainStartEndE-ValueType
Pfam:GATase_6 72 212 1e-19 PFAM
Pfam:GATase_4 75 206 1.6e-7 PFAM
Pfam:GATase_7 90 209 8.2e-16 PFAM
Pfam:SIS 363 492 1.7e-38 PFAM
Pfam:SIS 534 665 1.2e-29 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd2 T C 7: 79,348,430 Y237H probably damaging Het
Adprh T C 16: 38,446,087 E231G probably benign Het
Anks6 T C 4: 47,030,705 S631G probably benign Het
Bpifa5 T A 2: 154,165,606 L156H probably damaging Het
Bsn G A 9: 108,111,452 A2367V probably benign Het
C8b T C 4: 104,786,843 Y236H probably damaging Het
Celf2 C T 2: 6,547,145 G508S probably damaging Het
Clca1 T C 3: 145,005,061 T794A probably benign Het
Col27a1 T A 4: 63,319,464 probably benign Het
Cyp2j12 C T 4: 96,099,662 C497Y probably damaging Het
Dnmt3l T C 10: 78,052,768 I168T possibly damaging Het
Dtna C T 18: 23,590,341 Q201* probably null Het
Fetub T C 16: 22,934,235 S146P possibly damaging Het
Gak T G 5: 108,609,406 E242D probably benign Het
Ginm1 C T 10: 7,770,366 C290Y probably benign Het
Hepacam T C 9: 37,384,710 S386P probably damaging Het
Hmcn2 C A 2: 31,391,076 L1867I probably benign Het
Hnrnpa3 T G 2: 75,662,675 S220A unknown Het
Hydin A G 8: 110,462,735 E1257G probably damaging Het
Ier3ip1 C T 18: 76,930,178 A18V probably damaging Het
Ift140 T A 17: 25,094,677 C1361S probably damaging Het
Il16 T C 7: 83,652,143 Q955R probably damaging Het
Itpr3 T G 17: 27,107,303 M1349R probably damaging Het
Kcnk4 C T 19: 6,926,234 V316I probably benign Het
March6 A G 15: 31,482,549 I501T possibly damaging Het
Msl2 T A 9: 101,100,968 S180R probably benign Het
Muc16 C T 9: 18,657,924 V1100I unknown Het
Nbas T C 12: 13,566,250 V2263A possibly damaging Het
Olfr1416 C T 1: 92,480,465 S52N probably benign Het
Olfr853 C T 9: 19,537,537 R131H probably benign Het
Pdilt T G 7: 119,514,886 I130L possibly damaging Het
Phldb3 A G 7: 24,628,950 T640A probably damaging Het
Pole2 G C 12: 69,204,187 Y467* probably null Het
Pxdn C T 12: 30,002,044 T740M probably damaging Het
Rabac1 T C 7: 24,972,247 I83V probably damaging Het
Rrp7a T C 15: 83,117,572 Q245R probably damaging Het
Sae1 A G 7: 16,370,354 V110A probably damaging Het
Sema3c G T 5: 17,662,938 V116F probably damaging Het
Serpina3i A G 12: 104,265,704 Y200C probably damaging Het
Slc25a45 C T 19: 5,880,107 T35M probably benign Het
Speer4b C T 5: 27,498,820 R107Q probably benign Het
Sycp2 T C 2: 178,364,858 T843A probably damaging Het
Tecta T A 9: 42,332,560 I2004F probably damaging Het
Tma16 T C 8: 66,476,796 D182G possibly damaging Het
Topaz1 T A 9: 122,781,362 Y1167* probably null Het
Uck1 C A 2: 32,260,141 probably benign Het
Usp25 A G 16: 77,033,912 T19A probably damaging Het
Vpreb2 G A 16: 17,980,889 G80S probably damaging Het
Wdfy4 A G 14: 33,076,375 C2025R Het
Zyg11a T A 4: 108,217,906 H6L probably damaging Het
Other mutations in Gfpt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Gfpt2 APN 11 49809123 missense probably benign 0.00
IGL01451:Gfpt2 APN 11 49807690 splice site probably benign
IGL01490:Gfpt2 APN 11 49827127 splice site probably benign
IGL01550:Gfpt2 APN 11 49824323 splice site probably null
IGL01552:Gfpt2 APN 11 49805005 nonsense probably null
IGL02349:Gfpt2 APN 11 49807703 missense probably benign 0.02
IGL02815:Gfpt2 APN 11 49823257 missense possibly damaging 0.89
plethora UTSW 11 49824441 missense probably damaging 1.00
R0525:Gfpt2 UTSW 11 49829775 missense probably benign 0.06
R0539:Gfpt2 UTSW 11 49832898 missense probably damaging 1.00
R1055:Gfpt2 UTSW 11 49827211 missense probably damaging 1.00
R1178:Gfpt2 UTSW 11 49823309 missense probably benign 0.42
R1340:Gfpt2 UTSW 11 49832861 missense probably damaging 1.00
R2372:Gfpt2 UTSW 11 49807715 missense probably benign 0.00
R4154:Gfpt2 UTSW 11 49835778 splice site probably null
R4476:Gfpt2 UTSW 11 49824342 missense probably benign 0.17
R4679:Gfpt2 UTSW 11 49823737 missense probably benign 0.00
R4863:Gfpt2 UTSW 11 49810970 missense probably benign 0.06
R5113:Gfpt2 UTSW 11 49823799 missense probably damaging 1.00
R5509:Gfpt2 UTSW 11 49827146 missense possibly damaging 0.75
R5830:Gfpt2 UTSW 11 49809061 missense probably benign 0.03
R6435:Gfpt2 UTSW 11 49835651 missense probably benign 0.00
R7079:Gfpt2 UTSW 11 49837751 missense possibly damaging 0.77
R7135:Gfpt2 UTSW 11 49804955 missense probably damaging 1.00
R7261:Gfpt2 UTSW 11 49823251 missense possibly damaging 0.77
R7294:Gfpt2 UTSW 11 49818608 nonsense probably null
R7384:Gfpt2 UTSW 11 49810990 missense possibly damaging 0.56
R7778:Gfpt2 UTSW 11 49824441 missense probably damaging 1.00
R7806:Gfpt2 UTSW 11 49823315 missense probably benign
R7824:Gfpt2 UTSW 11 49824441 missense probably damaging 1.00
R8245:Gfpt2 UTSW 11 49823958 missense probably benign 0.01
R8262:Gfpt2 UTSW 11 49823780 missense probably benign 0.02
R8791:Gfpt2 UTSW 11 49823216 missense probably benign 0.01
R9072:Gfpt2 UTSW 11 49823358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAATGGCAGAGAAGTCCTC -3'
(R):5'- ACTCACCCGCAGAGTCATAG -3'

Sequencing Primer
(F):5'- AGAAGTCCTCTGCTGTGAAAC -3'
(R):5'- AGAGTCATAGCCCCGGTACTC -3'
Posted On 2021-01-22