Mutagenetix > Incidental Mutation

Incidental Mutation 'G1patch:Galnt13'

660665

Institutional Source

Beutler Lab

Gene Symbol

Galnt13

Ensembl Gene

ENSMUSG00000060988

Gene Name

polypeptide N-acetylgalactosaminyltransferase 13

Synonyms

pp-GalNAc-T13

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.157) question?

Stock #

G1patch (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

54436317-55118309 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 54855232 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 228 (D228G)

Ref Sequence

ENSEMBL: ENSMUSP00000108255 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068595] [ENSMUST00000112634] [ENSMUST00000112635] [ENSMUST00000112636]

AlphaFold

Q8CF93

Predicted Effect

probably damaging
Transcript: ENSMUST00000068595
AA Change: D228G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000063464
Gene: ENSMUSG00000060988
AA Change: D228G

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	115	368	1.5e-11	PFAM
Pfam:Glycos_transf_2	118	302	7.4e-35	PFAM
Pfam:Glyco_tranf_2_2	118	343	3.1e-7	PFAM
Pfam:Glyco_transf_7C	280	348	4.8e-9	PFAM
RICIN	427	550	9.63e-34	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112634
AA Change: D228G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108253
Gene: ENSMUSG00000060988
AA Change: D228G

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	115	367	2.7e-10	PFAM
Pfam:Glycos_transf_2	118	302	1.8e-38	PFAM
Pfam:Glyco_tranf_2_2	118	343	3.2e-7	PFAM
Pfam:Glyco_transf_7C	280	348	4.9e-10	PFAM
RICIN	427	586	5.34e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112635
AA Change: D228G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108254
Gene: ENSMUSG00000060988
AA Change: D228G

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	115	368	1.5e-11	PFAM
Pfam:Glycos_transf_2	118	302	7.4e-35	PFAM
Pfam:Glyco_tranf_2_2	118	343	3.1e-7	PFAM
Pfam:Glyco_transf_7C	280	348	4.8e-9	PFAM
RICIN	427	550	9.63e-34	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112636
AA Change: D228G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108255
Gene: ENSMUSG00000060988
AA Change: D228G

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
Pfam:Glyco_tranf_2_3	115	368	1.5e-11	PFAM
Pfam:Glycos_transf_2	118	302	7.4e-35	PFAM
Pfam:Glyco_tranf_2_2	118	343	3.1e-7	PFAM
Pfam:Glyco_transf_7C	280	348	4.8e-9	PFAM
RICIN	427	550	9.63e-34	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GALNT13 protein is a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAcT; EC 2.4.1.41) family, which initiate O-linked glycosylation of mucins (see MUC3A, MIM 158371) by the initial transfer of N-acetylgalactosamine (GalNAc) with an alpha-linkage to a serine or threonine residue.[supplied by OMIM, Apr 2004]
PHENOTYPE: Galnt13 is expressed exclusively in neuronal cells. Conditional animals can be used with cre-expressing strains to produce total or tissue-specific deletion of this locus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts18	T	C	8: 113,743,201	Y623C	probably damaging	Het
Adgrv1	T	C	13: 81,437,557	E4596G	probably damaging	Het
Adgrv1	A	T	13: 81,493,210	C3267S	probably damaging	Het
Ankrd40	T	G	11: 94,334,815	V224G	probably benign	Het
Ap3s2	C	T	7: 79,920,642		probably benign	Het
Apip	T	A	2: 103,092,525	D229E	possibly damaging	Het
Atp2b4	C	T	1: 133,706,987	R1168H	probably benign	Het
Bcan	T	C	3: 87,995,484	K329R	possibly damaging	Het
Camk1g	T	C	1: 193,350,320	D261G	possibly damaging	Het
Ccdc30	T	A	4: 119,331,599	Q490L	probably damaging	Het
Ccdc83	A	G	7: 90,247,053	W103R	probably damaging	Het
Ctsl	T	A	13: 64,366,623	R69*	probably null	Het
Dchs1	C	T	7: 105,758,793	R1944H	probably damaging	Het
Fgb	T	C	3: 83,043,791	Y305C	probably damaging	Het
Fras1	T	A	5: 96,781,340	Y3868N	possibly damaging	Het
Gal3st2	T	A	1: 93,873,702	S27T	probably benign	Het
Gk5	A	T	9: 96,155,470	T346S	probably benign	Het
Gnrhr	T	C	5: 86,185,313	I233V	probably damaging	Het
Greb1	T	C	12: 16,688,567	Y1465C	probably damaging	Het
H6pd	A	G	4: 149,996,358	L10P	probably damaging	Het
Hspg2	G	A	4: 137,515,307	G611E	probably damaging	Het
Ighv7-4	A	T	12: 114,222,869	D94E	probably damaging	Het
Lamb3	T	C	1: 193,304,582	Y59H	probably benign	Het
Msantd1	C	T	5: 34,921,421	T100I	probably damaging	Het
Msx3	T	A	7: 140,048,746		probably benign	Het
Mttp	C	A	3: 138,107,238	A559S	probably damaging	Het
Myh1	C	G	11: 67,201,893	D4E	probably damaging	Het
Olfr1018	A	G	2: 85,823,790	K273R	probably damaging	Het
Olfr1221	G	T	2: 89,112,296	T72N	possibly damaging	Het
Olfr1295	C	T	2: 111,564,907	C179Y	probably damaging	Het
Olfr596	A	T	7: 103,310,354	D211V	probably damaging	Het
Pcdhac1	T	C	18: 37,090,328	Y65H	probably damaging	Het
Pcdhga8	A	T	18: 37,727,262	Y457F	probably damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pja2	A	T	17: 64,289,967	M514K	probably damaging	Het
Plcxd2	T	C	16: 45,972,125	N284D	probably damaging	Het
Polr3d	A	T	14: 70,441,137	M129K	probably benign	Het
Ppp1r42	T	G	1: 9,999,507	E110A	probably damaging	Het
Prdm2	G	A	4: 143,132,901	T1273M	possibly damaging	Het
Prelid2	A	G	18: 41,912,449	I132T	possibly damaging	Het
Sergef	G	A	7: 46,632,667		probably null	Het
Slc24a2	C	A	4: 87,226,882		probably null	Het
Stxbp3	A	T	3: 108,827,600	D24E	possibly damaging	Het
Tas2r123	A	T	6: 132,847,838	M233L	probably damaging	Het
Thsd7a	G	A	6: 12,555,631	H85Y	possibly damaging	Het
Tlr2	T	A	3: 83,838,296	E160V	probably benign	Het
Tmem171	A	T	13: 98,692,170	C157*	probably null	Het
Trpm3	T	C	19: 22,926,028	Y1051H	probably damaging	Het
Vmn2r28	A	G	7: 5,488,409	F280L	probably benign	Het
Xpo7	A	T	14: 70,676,813	Y748N	probably damaging	Het
Zan	T	C	5: 137,438,520	S2024G	unknown	Het
Zfhx2	A	T	14: 55,064,082	Y2148*	probably null	Het
Zscan4-ps1	T	C	7: 11,065,979	T328A	probably benign	Het

Other mutations in Galnt13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Galnt13	APN	2	54516535	utr 5 prime	probably benign
IGL00769:Galnt13	APN	2	54880104	missense	probably benign	0.37
IGL01533:Galnt13	APN	2	54880132	missense	probably damaging	1.00
IGL01862:Galnt13	APN	2	54857914	missense	probably damaging	1.00
IGL02363:Galnt13	APN	2	55112860	missense	probably damaging	1.00
IGL02493:Galnt13	APN	2	54880137	missense	probably benign	0.05
IGL03108:Galnt13	APN	2	54854648	missense	probably benign	0.02
IGL03219:Galnt13	APN	2	54933435	missense	possibly damaging	0.85
R0142:Galnt13	UTSW	2	55098603	missense	probably damaging	1.00
R0324:Galnt13	UTSW	2	54854616	missense	probably benign	0.01
R0379:Galnt13	UTSW	2	55060492	missense	possibly damaging	0.72
R1321:Galnt13	UTSW	2	55098594	missense	probably damaging	0.98
R1509:Galnt13	UTSW	2	54733082	missense	probably damaging	1.00
R1521:Galnt13	UTSW	2	54854645	missense	probably benign
R1539:Galnt13	UTSW	2	54857857	missense	probably damaging	1.00
R1638:Galnt13	UTSW	2	54854655	missense	probably damaging	1.00
R1640:Galnt13	UTSW	2	55060546	missense	probably damaging	1.00
R2299:Galnt13	UTSW	2	55060583	missense	possibly damaging	0.61
R2365:Galnt13	UTSW	2	54854697	missense	possibly damaging	0.85
R2367:Galnt13	UTSW	2	55112944	missense	probably benign	0.00
R3687:Galnt13	UTSW	2	54880062	missense	probably benign	0.31
R3726:Galnt13	UTSW	2	55098657	missense	probably damaging	1.00
R3730:Galnt13	UTSW	2	54933507	missense	possibly damaging	0.91
R3731:Galnt13	UTSW	2	54933507	missense	possibly damaging	0.91
R4626:Galnt13	UTSW	2	54857866	missense	probably damaging	1.00
R4880:Galnt13	UTSW	2	55060572	missense	probably damaging	1.00
R4928:Galnt13	UTSW	2	54516565	missense	probably damaging	1.00
R5421:Galnt13	UTSW	2	54857896	missense	probably damaging	1.00
R6136:Galnt13	UTSW	2	54516479	start gained	probably benign
R6244:Galnt13	UTSW	2	54933548	missense	probably damaging	1.00
R6725:Galnt13	UTSW	2	54855232	missense	probably damaging	1.00
R7058:Galnt13	UTSW	2	55098575	missense	probably damaging	0.99
R7448:Galnt13	UTSW	2	54516564	missense	possibly damaging	0.94
R7635:Galnt13	UTSW	2	54857817	missense	probably damaging	1.00
R7889:Galnt13	UTSW	2	55112861	missense	probably benign	0.02
R8003:Galnt13	UTSW	2	55060485	nonsense	probably null
R8207:Galnt13	UTSW	2	54880110	missense	probably benign	0.00
R8525:Galnt13	UTSW	2	55060476	missense	possibly damaging	0.95
R8539:Galnt13	UTSW	2	54933572	splice site	probably null
R8885:Galnt13	UTSW	2	54880126	missense	probably benign
R8946:Galnt13	UTSW	2	54880063	missense	probably benign	0.29
R9306:Galnt13	UTSW	2	54933557	missense	probably benign	0.01
R9340:Galnt13	UTSW	2	54880149	missense	probably damaging	1.00
R9362:Galnt13	UTSW	2	54733052	missense	probably benign	0.00
R9444:Galnt13	UTSW	2	55112916	missense	probably benign
R9590:Galnt13	UTSW	2	54857961	missense	probably benign	0.02
R9779:Galnt13	UTSW	2	54733050	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TATGAGCTTGCAACTGCCCC -3'
(R):5'- ACCCATGCTTAACACGGATCAG -3'

Sequencing Primer
(F):5'- CAAGTTGACATTAGAGAACTACGTG -3'
(R):5'- GCTTAACACGGATCAGTATGATTTTC -3'

Posted On

2021-02-01