Incidental Mutation 'G1citation:Rexo4'
ID660717
Institutional Source Beutler Lab
Gene Symbol Rexo4
Ensembl Gene ENSMUSG00000052406
Gene NameREX4, 3'-5' exonuclease
SynonymsXPMC2H
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #G1citation (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location26953563-26964386 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26960271 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 275 (D275G)
Ref Sequence ENSEMBL: ENSMUSP00000121599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064244] [ENSMUST00000114020] [ENSMUST00000136710]
Predicted Effect probably damaging
Transcript: ENSMUST00000064244
AA Change: D275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070815
Gene: ENSMUSG00000052406
AA Change: D275G

DomainStartEndE-ValueType
low complexity region 16 34 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
EXOIII 229 390 2.55e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114020
AA Change: D298G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109653
Gene: ENSMUSG00000052406
AA Change: D298G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 39 57 N/A INTRINSIC
low complexity region 203 220 N/A INTRINSIC
EXOIII 252 413 2.55e-43 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000136710
AA Change: D275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121599
Gene: ENSMUSG00000052406
AA Change: D275G

DomainStartEndE-ValueType
low complexity region 16 34 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
EXOIII 229 363 1.57e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 94% (46/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam11 G A 11: 102,776,675 R687Q possibly damaging Het
AI987944 A G 7: 41,374,808 L249P probably damaging Het
Ankrd28 T A 14: 31,736,840 probably null Het
Bahcc1 T C 11: 120,287,721 S2369P probably damaging Het
Birc6 T C 17: 74,580,382 S902P possibly damaging Het
Birc6 A T 17: 74,598,044 K1277N probably damaging Het
Brwd1 T C 16: 96,041,274 E821G probably benign Het
Cct8l1 T C 5: 25,517,939 S551P possibly damaging Het
Cmtm1 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG 8: 104,309,702 probably null Het
Cyp2c39 A T 19: 39,536,817 D188V probably damaging Het
Dclk3 G T 9: 111,439,337 A25S probably benign Het
Dpep2 A T 8: 105,985,241 M518K probably benign Het
Dst T C 1: 34,275,674 V6462A probably damaging Het
Entpd3 T C 9: 120,562,038 probably null Het
Epm2aip1 T C 9: 111,272,556 V199A probably damaging Het
Fam193b A G 13: 55,541,691 probably benign Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fat1 A G 8: 45,026,404 D2829G probably damaging Het
Fcgbp T A 7: 28,107,356 Y2250N probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
H2-Aa C T 17: 34,287,677 probably null Het
Igsf9 T A 1: 172,497,163 S883T possibly damaging Het
Kcnh7 T G 2: 62,787,904 I414L probably damaging Het
Kcnma1 T C 14: 24,003,744 probably null Het
Kcnmb1 T C 11: 33,964,686 probably benign Het
Kmt2d A G 15: 98,849,459 probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Nlgn1 T C 3: 26,133,647 T30A probably benign Het
Nucb1 A G 7: 45,498,865 F175L probably damaging Het
Pax6 T A 2: 105,685,923 V182E probably benign Het
Ptger1 A G 8: 83,668,650 D252G probably benign Het
Ripk4 T C 16: 97,746,036 D342G probably damaging Het
Rpl10l A T 12: 66,284,213 C49S possibly damaging Het
Sema7a T C 9: 57,960,336 F457S probably damaging Het
Shank3 G A 15: 89,531,627 D155N probably damaging Het
Smpd3 G A 8: 106,265,964 probably benign Het
Smpd4 T C 16: 17,640,233 V465A probably damaging Het
Sohlh2 T C 3: 55,207,686 V364A probably damaging Het
Sos2 C T 12: 69,650,649 R99Q probably damaging Het
Spry2 G A 14: 105,893,357 Q132* probably null Het
Tbx19 G T 1: 165,140,140 P346Q probably damaging Het
Tdrd6 A G 17: 43,627,215 Y981H probably damaging Het
Tinag T C 9: 77,031,702 K165E probably benign Het
Tubb4a A T 17: 57,080,904 I374N probably damaging Het
Umodl1 C T 17: 30,986,554 Q708* probably null Het
Vmn2r3 A T 3: 64,287,455 V14E probably benign Het
Zfp82 G A 7: 30,056,287 L457F probably damaging Het
Other mutations in Rexo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01503:Rexo4 APN 2 26960633 missense probably benign 0.06
IGL02093:Rexo4 APN 2 26962518 missense probably benign 0.01
IGL02223:Rexo4 APN 2 26955499 missense probably damaging 1.00
IGL02823:Rexo4 APN 2 26962477 missense probably benign 0.06
R0685:Rexo4 UTSW 2 26958574 splice site probably benign
R1792:Rexo4 UTSW 2 26960236 missense probably benign 0.00
R4912:Rexo4 UTSW 2 26962392 missense possibly damaging 0.78
R4934:Rexo4 UTSW 2 26960334 missense probably damaging 0.99
R5808:Rexo4 UTSW 2 26964185 missense probably damaging 0.98
R6822:Rexo4 UTSW 2 26960271 missense probably damaging 1.00
R7630:Rexo4 UTSW 2 26960610 missense probably damaging 1.00
R7673:Rexo4 UTSW 2 26958493 missense probably benign 0.11
R7728:Rexo4 UTSW 2 26964230 missense probably benign 0.08
R8245:Rexo4 UTSW 2 26960338 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCTGCAAAGTCTGGGGAAG -3'
(R):5'- GAATGAGGCTTGGCTCACTG -3'

Sequencing Primer
(F):5'- GAGCTAAGCAGTGTCAGGACCC -3'
(R):5'- AGCCCGTGATATCTATTACACTGGG -3'
Posted On2021-02-01